ID: 904813556

View in Genome Browser
Species Human (GRCh38)
Location 1:33179742-33179764
Sequence CAGCCCCATGTACCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904813556_904813560 16 Left 904813556 1:33179742-33179764 CCAAAGCCAGGTACATGGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 904813560 1:33179781-33179803 TAGCTTGAAAAAAGGATTCCAGG 0: 1
1: 0
2: 7
3: 15
4: 212
904813556_904813559 8 Left 904813556 1:33179742-33179764 CCAAAGCCAGGTACATGGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 904813559 1:33179773-33179795 AAGTGATTTAGCTTGAAAAAAGG 0: 1
1: 0
2: 1
3: 35
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904813556 Original CRISPR CAGCCCCATGTACCTGGCTT TGG (reversed) Intronic
900185604 1:1331782-1331804 CAGCCTCATGTTCCTGGCCAAGG + Exonic
900458294 1:2787789-2787811 CGTCTCCATGTACCTGGCCTGGG + Intronic
900647131 1:3714047-3714069 CAGCTCCTTGCACCTGGCGTTGG + Intronic
900881177 1:5382427-5382449 CAGCGCCATGTTCCTGACTTAGG - Intergenic
900905331 1:5552957-5552979 TGGCCCCATGTACCTGCCCTGGG - Intergenic
902339927 1:15776404-15776426 CATCCCCAAGGACCTGACTTTGG + Intronic
903304481 1:22402943-22402965 CAGCCCCAGCACCCTGGCTTGGG + Intergenic
904256680 1:29259103-29259125 CACCCCCAACTAGCTGGCTTGGG + Intronic
904695901 1:32331231-32331253 AAGGCCCATGTCCCTGGTTTAGG - Intronic
904813556 1:33179742-33179764 CAGCCCCATGTACCTGGCTTTGG - Intronic
905369859 1:37477191-37477213 CAGCCTCATGTAGCTGGGCTAGG + Intronic
907311725 1:53542667-53542689 CAGACGCATGTACATGGCATGGG + Intronic
908140473 1:61179245-61179267 CAGACTGATGCACCTGGCTTTGG + Intronic
911757730 1:101579387-101579409 CAGCCTCATCCTCCTGGCTTAGG - Intergenic
913044795 1:115064775-115064797 CATCCTCATGTGCTTGGCTTTGG - Intronic
916886151 1:169070409-169070431 CAGCCTCATGTTACTGCCTTGGG + Intergenic
920549389 1:206845908-206845930 AGGCCCCATCTTCCTGGCTTTGG + Intergenic
922343829 1:224679772-224679794 CAGCCCCATGTTGCTGGATTGGG + Intronic
923965595 1:239135121-239135143 AAACACCATGTACCTGGTTTGGG - Intergenic
1070791981 10:79195084-79195106 CCTCCCCATGGACCTGCCTTGGG + Intronic
1073370078 10:102980350-102980372 CAGCCTCAACTTCCTGGCTTAGG + Intronic
1075219726 10:120574623-120574645 CAGCCCCAGGTTTTTGGCTTGGG - Intronic
1081580958 11:44351438-44351460 CAGCCCCCTCTGCCTGACTTTGG + Intergenic
1083158103 11:60837988-60838010 CAGCCCCATGTCCCAGTCCTAGG + Intergenic
1084639387 11:70415512-70415534 CTGCCACCTGCACCTGGCTTAGG + Intronic
1084865181 11:72050028-72050050 CACCCACATGTGCCTCGCTTTGG - Intronic
1086933467 11:92719006-92719028 GAACACCATGTACCTGGATTAGG + Intronic
1087170155 11:95041737-95041759 AAGCCCCTTGAACCTGGCTGAGG + Intergenic
1089587695 11:119520644-119520666 CAGCTCCCTGCACCTGGCTCTGG + Intergenic
1090333127 11:125946487-125946509 CAACCCCATGGACATTGCTTTGG - Intergenic
1090805824 11:130201475-130201497 CAGACCCATGCACAGGGCTTGGG + Intronic
1090935390 11:131337244-131337266 CAGCACCATGTACCAATCTTGGG - Intergenic
1091132852 11:133160971-133160993 CAGCTCCATGTACCTGGGCCGGG - Intronic
1092965980 12:13642841-13642863 CAGGGCCATGGAGCTGGCTTTGG + Intronic
1094214463 12:27925690-27925712 CAGCCACCTGTACCTGGCCTGGG + Intergenic
1096529590 12:52234372-52234394 CAGCCCTGAGTTCCTGGCTTTGG - Intronic
1098246263 12:68521431-68521453 CAGCCCCTTCTTCCTGGCTCTGG + Intergenic
1098308467 12:69124665-69124687 GAGCCCCATGTAACTAGTTTTGG + Intergenic
1098547910 12:71731668-71731690 CACCCCCATGGACCTAGCTAAGG + Intergenic
1103732803 12:123039079-123039101 GAGCCCCATGTTCCTGCCCTGGG - Intronic
1104437928 12:128770637-128770659 CAGCCTCATCTCCCAGGCTTTGG + Intergenic
1118029885 14:61809487-61809509 CAGCCCCATGTAACTGCATAAGG - Intergenic
1119102476 14:71892944-71892966 CCGTCCCATGAAGCTGGCTTGGG - Intergenic
1122723267 14:103734276-103734298 CAGCCCCGTCTACCTGGCCCTGG + Exonic
1124105215 15:26731424-26731446 CAGCTCCATGGACCTCACTTTGG + Intronic
1126672518 15:51129291-51129313 CAGTCCCATGCACCAGGTTTAGG + Intergenic
1129666592 15:77582737-77582759 CAGCCCCCTGCAACTGGCCTAGG - Intergenic
1129670501 15:77605368-77605390 CAGCTCCAGTTCCCTGGCTTAGG - Intergenic
1132394484 15:101462881-101462903 CAGCCCCAGGCACATGGCTATGG + Intronic
1133971916 16:10574383-10574405 CATCCCCAAGAACCTGGCTAAGG - Intronic
1141788559 16:86217655-86217677 CGGCCCCATGTGTGTGGCTTGGG + Intergenic
1142536778 17:623101-623123 CAGGCCTGTATACCTGGCTTTGG + Intronic
1143487292 17:7261894-7261916 CAGCCCCTTGTACATGGCCTGGG + Exonic
1144416331 17:15050812-15050834 CAGCTCCAGGTACCTGACATTGG - Intergenic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1148680144 17:49469068-49469090 TATCCCCATGTTGCTGGCTTGGG + Intronic
1150232519 17:63564740-63564762 CAGGCCCATGCACCTGTCTCGGG + Intronic
1151002902 17:70399286-70399308 CAGCCCCAGCTGCCTGCCTTTGG - Intergenic
1151534606 17:74731532-74731554 CAGCCCCATCAAACTGGCTGTGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1151951404 17:77356283-77356305 CAGCCCCATCTCCCTGCCTTGGG + Intronic
1153446662 18:5180364-5180386 CAGTCACATGCACCTGGCCTGGG - Intronic
1158675067 18:59510986-59511008 CAGCCCCATTCAGCTGGCTCTGG + Intronic
1160828613 19:1092109-1092131 CAGCCCCCTGTCCCTGTCTCCGG - Intronic
1161204811 19:3035485-3035507 CAGCCCCTGGTTCCTGGCTAGGG + Intronic
1161950399 19:7464529-7464551 CATCCTCATGCCCCTGGCTTGGG + Intronic
1162327899 19:10009564-10009586 CAGCACCATGGACAGGGCTTCGG - Intronic
1163308252 19:16496114-16496136 CACCCCCATGGCCCGGGCTTTGG - Exonic
1164143942 19:22498825-22498847 CAGCACCATGTGTCTGGCTCAGG - Intronic
1165113369 19:33514635-33514657 CAGCCTCATGTGCCTGTCGTTGG - Intronic
1165472350 19:36010756-36010778 CACCTCCCTGTCCCTGGCTTGGG - Intronic
1165597051 19:37018170-37018192 CATCCCCATGTTCATGGATTGGG + Intronic
1165795330 19:38516071-38516093 CAGCCCCGTCTTCCAGGCTTCGG + Exonic
926801538 2:16664814-16664836 CAGCCCCATGACCCTGTCTTGGG + Intronic
930342368 2:50133170-50133192 AATCCCCATGTAGCTGGCTTAGG + Intronic
930624182 2:53678600-53678622 CAACCCCATGCACCCGACTTTGG + Intronic
936724456 2:115296158-115296180 CAGACCCAGGTTTCTGGCTTGGG + Intronic
936757423 2:115731443-115731465 CAGCCTCAACTTCCTGGCTTAGG - Intronic
937285310 2:120747185-120747207 CAGCAGTATGTACCTAGCTTTGG + Intronic
937353298 2:121182386-121182408 CATCACCATGTACCTGGCCTAGG - Intergenic
946901827 2:224380386-224380408 CAGCCCCAAATACCTCTCTTTGG + Intronic
947460188 2:230297602-230297624 CAGGCACATCTACCTGGCTTGGG - Intronic
947470460 2:230396938-230396960 CAAGCACATCTACCTGGCTTGGG - Intronic
948112237 2:235465187-235465209 CAGCCCCATTTACCTGGAGCTGG + Intergenic
948551818 2:238777978-238778000 CAGCCCCATTTGCCTGGCAAAGG - Intergenic
948890028 2:240903111-240903133 CTGCCCCACCTGCCTGGCTTTGG - Intergenic
1168808584 20:687949-687971 CAGCACCATGTTCCAGGCTACGG - Intergenic
1169264568 20:4160136-4160158 CTGCCCCATGCAGCTGGATTAGG - Intronic
1170792450 20:19519037-19519059 CAGCCCCATGGCCCTCTCTTGGG - Intronic
1170947239 20:20902127-20902149 CAGCACCATGTACAATGCTTGGG + Intergenic
1172876991 20:38170422-38170444 CAACCCCAAGAACCTGGCTTGGG - Intergenic
1175897599 20:62346296-62346318 CATCCCCATGGCCCTGGCTGGGG - Intronic
1176046855 20:63097274-63097296 CACAACCCTGTACCTGGCTTGGG + Intergenic
1176082814 20:63282414-63282436 CAGCCCCATCTACCCTGCTGTGG - Intronic
1176377052 21:6091970-6091992 CAGGCCCAGGCACATGGCTTGGG + Intergenic
1179746423 21:43446274-43446296 CAGGCCCAGGCACATGGCTTGGG - Intergenic
1181039427 22:20184847-20184869 CAGCCCCAAGTCCATGGCTGGGG - Intergenic
1183979430 22:41531025-41531047 CAGCCCCATGCACAAGGCCTGGG + Intronic
1184377047 22:44120165-44120187 CAGCCCCAGGTACAGGGCCTGGG + Intronic
950184575 3:10937280-10937302 CAAACCCAGGCACCTGGCTTTGG + Intronic
953982294 3:47418831-47418853 CAGGCTGATGTACCTGGATTCGG + Exonic
954361425 3:50124719-50124741 CAGCCCTATGCCCCTGTCTTTGG - Intergenic
954970676 3:54649306-54649328 CTGCCCCTTGAACCTGGTTTTGG + Intronic
957572662 3:81968364-81968386 CAGCCCATGGTACCTGGTTTTGG + Intergenic
961383176 3:126508902-126508924 TGGCCCCATGTGCCTGTCTTGGG - Intronic
962627954 3:137246097-137246119 CAGTCCCATGTACCAGGCCTGGG + Intergenic
962732830 3:138299276-138299298 CAGCCCCTGGCTCCTGGCTTTGG + Intronic
963948495 3:151171911-151171933 CAGCCCCAAGTACCATGCATGGG + Intronic
966932629 3:184685731-184685753 CAGCCCCAAGAGCCTGGCTTAGG - Intergenic
967511832 3:190322057-190322079 CAGCCCCTCGTACATGGCCTGGG + Exonic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
973228956 4:47820004-47820026 CAGCCCCATCTCCCAGGGTTTGG + Intronic
981081365 4:140642326-140642348 CACCCCTATCTTCCTGGCTTTGG + Intronic
985618412 5:938400-938422 CAGCCCAGTGGCCCTGGCTTTGG + Intergenic
985887951 5:2694811-2694833 CATCACCATGTACCAGGCTGGGG - Intergenic
985913388 5:2899680-2899702 AAGCCCCCTGTACCAGGCGTAGG - Intergenic
993475335 5:88357594-88357616 CAGGCCTTTGTCCCTGGCTTTGG - Intergenic
995254765 5:110033882-110033904 CGTCCCTATGTGCCTGGCTTTGG + Intergenic
996749323 5:126873154-126873176 CAGGCCCGTGTGCCTGGCTCCGG - Intronic
997303776 5:132824381-132824403 CAGCCGTATGGAACTGGCTTAGG - Exonic
997502502 5:134387600-134387622 CAGCACCAAGGACCTTGCTTAGG - Intronic
999307230 5:150527596-150527618 CAGCACCTAGTGCCTGGCTTTGG + Intronic
999466813 5:151815067-151815089 CAGGGCCATGTACCTGTCTTTGG - Intergenic
999531747 5:152470654-152470676 TAGCTCCATGTCTCTGGCTTTGG + Intergenic
1000065558 5:157690619-157690641 CAGCCCCACGTTCCTGGCAAGGG - Intergenic
1001518543 5:172374189-172374211 CTGCCCCATGTCTATGGCTTAGG - Intronic
1002169518 5:177367330-177367352 CAGCCCCAAGGACCCGGCCTGGG + Intronic
1003908228 6:10721153-10721175 CAGCCCCCTGTGTCTGGCTCAGG + Intergenic
1004503627 6:16230079-16230101 CGGCCCCCTGGACCTGGCTTTGG + Intergenic
1005849002 6:29804720-29804742 CAGCCTCATATCCGTGGCTTTGG - Intergenic
1007406289 6:41637970-41637992 CAGATCCCTGTCCCTGGCTTAGG + Intronic
1007685510 6:43665182-43665204 CCACCCCATCTAGCTGGCTTTGG - Intronic
1008712673 6:54247661-54247683 CAGACCCATCTTCCTGGCATTGG - Intronic
1009204150 6:60781444-60781466 AAGACCCATGTATCTGGATTGGG + Intergenic
1010562609 6:77369138-77369160 CACCCCCATGGACCTAGCTGAGG - Intergenic
1013285580 6:108678744-108678766 CACGCCAATGCACCTGGCTTAGG - Intronic
1017928483 6:158931105-158931127 CAGCCCCAACTTCCTGGCTGGGG - Intergenic
1018726174 6:166614947-166614969 CAGCTCCAGGTTCCAGGCTTAGG + Intronic
1019559833 7:1650547-1650569 CAGCCTCATCTGCCTGGCTCGGG - Intergenic
1023863779 7:44229374-44229396 CAGCCCCATGTAAGTAGCCTGGG - Exonic
1026074850 7:67156859-67156881 AAGCCTCCTGTACCAGGCTTAGG + Intronic
1026702008 7:72655303-72655325 AAGCCTCCTGTACCAGGCTTAGG - Intronic
1033655973 7:143374702-143374724 CAGCCACACCTACCTGCCTTGGG + Intergenic
1034381618 7:150700842-150700864 CAGCCCCATGAAACTGATTTTGG - Intergenic
1035719975 8:1784649-1784671 AAGCCCCATGTCCCTGGCACAGG + Exonic
1036288084 8:7462351-7462373 CAGCCCCATGCCCTTAGCTTTGG - Intronic
1036333391 8:7849177-7849199 CAGCCCCATGCCCTTAGCTTTGG + Intronic
1036408869 8:8479806-8479828 CAGGGCCATGTAGCTGGATTTGG + Intergenic
1037421299 8:18705982-18706004 CACACCCATGTAACTTGCTTTGG + Intronic
1038925970 8:32139847-32139869 AAGACCCATGTAGCTGACTTTGG + Intronic
1040436865 8:47399399-47399421 CAGGCACATGTATCTGGCTTGGG + Intronic
1041509658 8:58641814-58641836 CAGCCCCATGTAGGTGTATTTGG - Intronic
1042218303 8:66449199-66449221 CATCCCTATGTCCCTGGCTGTGG - Intronic
1043238515 8:77900032-77900054 CATCCCCATGGACCTGGGTGAGG - Intergenic
1044456684 8:92398670-92398692 CAGGGACATGTACCTGGGTTGGG + Intergenic
1044607106 8:94057297-94057319 TATCCCTAGGTACCTGGCTTTGG + Intergenic
1045907183 8:107360471-107360493 CAGCCCCATGTTCTTGGTTAGGG + Intronic
1047253335 8:123197087-123197109 CAGCCACAGGTAACTGGCTCAGG - Intronic
1050364263 9:4859681-4859703 TGTCCCAATGTACCTGGCTTAGG - Intronic
1052860846 9:33436932-33436954 CATCTCCATGTCCCGGGCTTTGG - Intergenic
1055544786 9:77358359-77358381 CAGCACCATGTATCTGATTTTGG - Exonic
1056632183 9:88303069-88303091 CAGCCACATCTACTGGGCTTTGG - Intergenic
1058584522 9:106492508-106492530 CACCCCCATGGACCTGGGTGAGG - Intergenic
1059461572 9:114434139-114434161 CAACCCCAAGTGCCTTGCTTAGG + Intronic
1060220339 9:121761134-121761156 CAGCCCCACCTACCCGGTTTGGG + Intronic
1060722807 9:125989784-125989806 CAGCCCCTTGCACATGGGTTTGG + Intergenic
1061872212 9:133527079-133527101 CACCACCATGTGCCAGGCTTGGG - Intronic
1061924658 9:133800124-133800146 CAGCCCCAGGAACTGGGCTTTGG - Intronic
1188005008 X:25011167-25011189 CAACCCCAGGTCCCAGGCTTCGG - Intronic
1189409940 X:40761121-40761143 CAGTCCCTTGTACATGGCCTGGG + Intergenic
1190049682 X:47140460-47140482 CAGCCACATGTAAGTGGATTTGG + Intergenic
1192106472 X:68322050-68322072 CAGCCTCAACTACCTGGCTCAGG + Intronic
1192171606 X:68859015-68859037 CAGCCCCATGGCTCTGGCTGAGG + Intergenic
1193164344 X:78264183-78264205 CTGCCCCATCTCCCTGGCTCTGG + Intergenic
1194628949 X:96259400-96259422 TAGCCCCAAATCCCTGGCTTTGG + Intergenic
1198525853 X:137500008-137500030 CAGCCCCATGCACCTAGACTAGG + Intergenic
1200097046 X:153669340-153669362 CAGTCCCAGGCACCTGGCTGAGG + Intergenic