ID: 904813804

View in Genome Browser
Species Human (GRCh38)
Location 1:33181019-33181041
Sequence GCGCACCTGCAGCTCGTCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904813792_904813804 6 Left 904813792 1:33180990-33181012 CCCCGCCCCTTCCCCAGGCAGGC 0: 1
1: 0
2: 8
3: 88
4: 831
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813797_904813804 1 Left 904813797 1:33180995-33181017 CCCCTTCCCCAGGCAGGCCGGGT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813783_904813804 23 Left 904813783 1:33180973-33180995 CCCCACCTCCAGCCCGGCCCCGC 0: 1
1: 2
2: 17
3: 154
4: 1246
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813794_904813804 4 Left 904813794 1:33180992-33181014 CCGCCCCTTCCCCAGGCAGGCCG 0: 1
1: 1
2: 5
3: 75
4: 696
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813801_904813804 -6 Left 904813801 1:33181002-33181024 CCCAGGCAGGCCGGGTAGCGCAC 0: 1
1: 0
2: 1
3: 6
4: 98
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813798_904813804 0 Left 904813798 1:33180996-33181018 CCCTTCCCCAGGCAGGCCGGGTA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813800_904813804 -5 Left 904813800 1:33181001-33181023 CCCCAGGCAGGCCGGGTAGCGCA 0: 1
1: 0
2: 1
3: 11
4: 86
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813784_904813804 22 Left 904813784 1:33180974-33180996 CCCACCTCCAGCCCGGCCCCGCC 0: 1
1: 2
2: 12
3: 130
4: 1172
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813785_904813804 21 Left 904813785 1:33180975-33180997 CCACCTCCAGCCCGGCCCCGCCC 0: 1
1: 4
2: 55
3: 374
4: 2587
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813793_904813804 5 Left 904813793 1:33180991-33181013 CCCGCCCCTTCCCCAGGCAGGCC 0: 1
1: 0
2: 9
3: 135
4: 1072
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813786_904813804 18 Left 904813786 1:33180978-33181000 CCTCCAGCCCGGCCCCGCCCCTT 0: 1
1: 0
2: 17
3: 148
4: 1132
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813782_904813804 27 Left 904813782 1:33180969-33180991 CCGGCCCCACCTCCAGCCCGGCC 0: 1
1: 1
2: 28
3: 292
4: 2988
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813781_904813804 28 Left 904813781 1:33180968-33180990 CCCGGCCCCACCTCCAGCCCGGC 0: 1
1: 1
2: 31
3: 387
4: 2646
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813790_904813804 10 Left 904813790 1:33180986-33181008 CCGGCCCCGCCCCTTCCCCAGGC 0: 1
1: 0
2: 42
3: 262
4: 1965
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813787_904813804 15 Left 904813787 1:33180981-33181003 CCAGCCCGGCCCCGCCCCTTCCC 0: 1
1: 5
2: 97
3: 692
4: 3395
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813799_904813804 -1 Left 904813799 1:33180997-33181019 CCTTCCCCAGGCAGGCCGGGTAG 0: 1
1: 0
2: 2
3: 23
4: 204
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813802_904813804 -7 Left 904813802 1:33181003-33181025 CCAGGCAGGCCGGGTAGCGCACC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904813788_904813804 11 Left 904813788 1:33180985-33181007 CCCGGCCCCGCCCCTTCCCCAGG 0: 1
1: 1
2: 29
3: 225
4: 1713
Right 904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904813804 Original CRISPR GCGCACCTGCAGCTCGTCGA AGG Exonic