ID: 904820395

View in Genome Browser
Species Human (GRCh38)
Location 1:33239281-33239303
Sequence CCCTATTAGGGCCCACGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904820395_904820401 -3 Left 904820395 1:33239281-33239303 CCCAAACGTGGGCCCTAATAGGG No data
Right 904820401 1:33239301-33239323 GGGGCCCCAAATGTTCCCTCTGG No data
904820395_904820402 -2 Left 904820395 1:33239281-33239303 CCCAAACGTGGGCCCTAATAGGG No data
Right 904820402 1:33239302-33239324 GGGCCCCAAATGTTCCCTCTGGG No data
904820395_904820409 19 Left 904820395 1:33239281-33239303 CCCAAACGTGGGCCCTAATAGGG No data
Right 904820409 1:33239323-33239345 GGGTCCCCTAGATCATTTCCTGG No data
904820395_904820403 -1 Left 904820395 1:33239281-33239303 CCCAAACGTGGGCCCTAATAGGG No data
Right 904820403 1:33239303-33239325 GGCCCCAAATGTTCCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904820395 Original CRISPR CCCTATTAGGGCCCACGTTT GGG (reversed) Intergenic
No off target data available for this crispr