ID: 904822826

View in Genome Browser
Species Human (GRCh38)
Location 1:33256450-33256472
Sequence GCGGCGGCGGCGGCGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5771
Summary {0: 182, 1: 288, 2: 633, 3: 1353, 4: 3315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822826_904822836 12 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822836 1:33256485-33256507 AGAACCCAGAAGTGAACAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 230
904822826_904822840 24 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822826_904822839 20 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822826 Original CRISPR GCGGCGGCGGCGGCGGCGGC GGG (reversed) Intergenic