ID: 904822831

View in Genome Browser
Species Human (GRCh38)
Location 1:33256460-33256482
Sequence AAGCGCCGAGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 20, 3: 144, 4: 741}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822831_904822841 25 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822831_904822840 14 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822831_904822836 2 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822836 1:33256485-33256507 AGAACCCAGAAGTGAACAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 230
904822831_904822839 10 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822831 Original CRISPR AAGCGCCGAGGCGGCGGCGG CGG (reversed) Intergenic