ID: 904822834

View in Genome Browser
Species Human (GRCh38)
Location 1:33256469-33256491
Sequence GGGTTCTGCAAGCGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822834_904822839 1 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822834_904822840 5 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822834_904822841 16 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822834_904822836 -7 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822836 1:33256485-33256507 AGAACCCAGAAGTGAACAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822834 Original CRISPR GGGTTCTGCAAGCGCCGAGG CGG (reversed) Intergenic