ID: 904822839

View in Genome Browser
Species Human (GRCh38)
Location 1:33256493-33256515
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822825_904822839 23 Left 904822825 1:33256447-33256469 CCTCCCGCCGCCGCCGCCGCCGC 0: 53
1: 298
2: 553
3: 1250
4: 3375
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822832_904822839 7 Left 904822832 1:33256463-33256485 CCGCCGCCGCCTCGGCGCTTGCA 0: 1
1: 0
2: 1
3: 9
4: 197
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822833_904822839 4 Left 904822833 1:33256466-33256488 CCGCCGCCTCGGCGCTTGCAGAA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822824_904822839 27 Left 904822824 1:33256443-33256465 CCAGCCTCCCGCCGCCGCCGCCG 0: 2
1: 16
2: 115
3: 456
4: 1830
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822830_904822839 13 Left 904822830 1:33256457-33256479 CCGCCGCCGCCGCCGCCTCGGCG 0: 3
1: 22
2: 316
3: 2257
4: 3967
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822823_904822839 28 Left 904822823 1:33256442-33256464 CCCAGCCTCCCGCCGCCGCCGCC 0: 1
1: 5
2: 33
3: 300
4: 1447
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822828_904822839 16 Left 904822828 1:33256454-33256476 CCGCCGCCGCCGCCGCCGCCTCG 0: 13
1: 258
2: 1794
3: 2744
4: 5254
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822834_904822839 1 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822827_904822839 19 Left 904822827 1:33256451-33256473 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822826_904822839 20 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822831_904822839 10 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126
904822835_904822839 -2 Left 904822835 1:33256472-33256494 CCTCGGCGCTTGCAGAACCCAGA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 904822839 1:33256493-33256515 GAAGTGAACAGCAGGCGACCCGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type