ID: 904822840

View in Genome Browser
Species Human (GRCh38)
Location 1:33256497-33256519
Sequence TGAACAGCAGGCGACCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 53}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822833_904822840 8 Left 904822833 1:33256466-33256488 CCGCCGCCTCGGCGCTTGCAGAA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822826_904822840 24 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822834_904822840 5 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822831_904822840 14 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822828_904822840 20 Left 904822828 1:33256454-33256476 CCGCCGCCGCCGCCGCCGCCTCG 0: 13
1: 258
2: 1794
3: 2744
4: 5254
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822830_904822840 17 Left 904822830 1:33256457-33256479 CCGCCGCCGCCGCCGCCTCGGCG 0: 3
1: 22
2: 316
3: 2257
4: 3967
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822835_904822840 2 Left 904822835 1:33256472-33256494 CCTCGGCGCTTGCAGAACCCAGA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822827_904822840 23 Left 904822827 1:33256451-33256473 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822832_904822840 11 Left 904822832 1:33256463-33256485 CCGCCGCCGCCTCGGCGCTTGCA 0: 1
1: 0
2: 1
3: 9
4: 197
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822825_904822840 27 Left 904822825 1:33256447-33256469 CCTCCCGCCGCCGCCGCCGCCGC 0: 53
1: 298
2: 553
3: 1250
4: 3375
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822840 Original CRISPR TGAACAGCAGGCGACCCGGA AGG Intergenic
900438309 1:2641643-2641665 TCAGCAGCAGGCGACCCTGACGG + Exonic
903319108 1:22531388-22531410 ACAAGAGCAGGAGACCCGGATGG + Intergenic
904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG + Intergenic
910208309 1:84769787-84769809 TTAACAGCAGGCGACCCTGGAGG - Intergenic
915259153 1:154663643-154663665 TGAACAGCAGGCAACAAGGAAGG - Intergenic
919042063 1:192401728-192401750 TGATGAGCAGGGGACCCAGAAGG + Intergenic
921221074 1:212974326-212974348 TGAAATGCAGGTGGCCCGGAGGG + Intronic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1076402166 10:130191381-130191403 TGAGCAGACGGCGACCCGGTGGG - Intergenic
1080196230 11:29612668-29612690 TGACCAGCAGGAGTCCCGGTGGG - Intergenic
1086058057 11:82671549-82671571 TGAAAAACAGGAGACCCAGAGGG + Intergenic
1090944915 11:131421088-131421110 TGAAGAGAATTCGACCCGGAGGG + Intronic
1091217878 11:133914598-133914620 TGGACAGCAGGTGTCCCGGAAGG - Intronic
1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG + Intergenic
1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG + Intergenic
1099111117 12:78562536-78562558 GGAACAGCAGGAGACCAGTATGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1112388901 13:98964833-98964855 TGAGCAGCAGGCCTCCCAGATGG + Intronic
1121402551 14:93692927-93692949 TGAGGAGCAGGGGACCTGGAGGG + Intronic
1124061108 15:26294323-26294345 TGAAGAGCAGGCGACAGGCAAGG + Intergenic
1129865832 15:78907901-78907923 AGAACAGCAAGCCACCAGGAAGG - Intergenic
1134220342 16:12348618-12348640 TGAAGAGCAGAGGACCTGGAAGG - Intronic
1139965673 16:70744126-70744148 AGACCAGCAGCCGACCCAGATGG + Intronic
1142134940 16:88447497-88447519 TGGACAGCAGACGACACGGGGGG - Intergenic
1142644040 17:1300713-1300735 TGGACACCAGGGGACCTGGACGG + Exonic
1144879078 17:18421671-18421693 TGAGAAGCAGGACACCCGGAAGG + Intergenic
1145960049 17:28881965-28881987 TGAACAGCAGAAGATCCGGCAGG - Exonic
1150801478 17:68286462-68286484 TGTACAGCAGGAGCCCTGGAAGG - Intronic
1153510446 18:5846262-5846284 TCAACAGCAGCAGACCCAGAAGG - Intergenic
1161571994 19:5035818-5035840 TCCACAGCATGGGACCCGGACGG - Intronic
1168107412 19:54173199-54173221 TGGCCAGCAGGTGGCCCGGAGGG + Exonic
925466059 2:4108366-4108388 AGGACTGCAGGCGACCTGGAAGG - Intergenic
934843632 2:97647083-97647105 TGAAGAGCAGGCGACTGGGTTGG + Exonic
936976541 2:118226751-118226773 GGAACAGCATGCAATCCGGAGGG + Intergenic
937994422 2:127681739-127681761 TGAACATCAGGCTACTCGGCCGG - Intronic
938406002 2:131033521-131033543 TGAACAGCTGGCCACCCAGAAGG - Intronic
944413616 2:199463633-199463655 TGGACTGCAGGCGACGCGGAAGG - Intronic
944820977 2:203430645-203430667 GGAACAGCAGGCGCCTCTGAGGG - Exonic
947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG + Intronic
1175317411 20:58058664-58058686 TGCACAGCAGGCTACCAGGATGG + Intergenic
1181482910 22:23212289-23212311 TGTACAGGAGGGGACCCTGAAGG + Intronic
1181537977 22:23556502-23556524 GGAGCAGCAGGCCACCAGGAGGG + Intergenic
1183721365 22:39564504-39564526 TGAAAAGAATGAGACCCGGAAGG - Intergenic
1185389520 22:50551385-50551407 TGCAGTGCAGGCGACCTGGATGG - Exonic
953769268 3:45766154-45766176 TGGTCAGCAGGCAACCAGGAGGG + Intronic
962411737 3:135146847-135146869 TGAACAGCAGTGGACCCAGAAGG + Intronic
971709587 4:30093495-30093517 AGTACAGAAGGCGACCCGGGCGG - Intergenic
972554360 4:40166269-40166291 TGAACAGCAGGCTATCTGGCGGG + Intergenic
973983137 4:56323492-56323514 GGAGCAGCAGGCGACGCGGGAGG + Exonic
976390219 4:84498452-84498474 AGAAAAGCAGGCGTCCCGGCGGG + Intergenic
985133213 4:186759565-186759587 TGAAAAGCAAGCGGCCCGGAAGG - Intergenic
985477789 5:89662-89684 TGAGCAGCAGGGGACGGGGAGGG - Intergenic
985506577 5:284997-285019 TGTGCAGCTGGAGACCCGGATGG - Intronic
986505482 5:8445689-8445711 TGAACAGCAGGCTAGCAGCAGGG + Intergenic
1003390979 6:5712501-5712523 TGAACAGCAGGTGAACAGTAGGG - Intronic
1018463674 6:164022789-164022811 TGAACAGCAGGCGCCCTGAAGGG - Intergenic
1021614694 7:22489607-22489629 TGAACAGCATGTGACCGTGAAGG + Intronic
1043486600 8:80704405-80704427 TGTACAGCAGGAGACAGGGATGG - Intronic
1043720091 8:83537121-83537143 GGAGCAGCAGGCAACCTGGAAGG - Intergenic
1058421889 9:104840513-104840535 TGAACAGCTGGCGTCAGGGATGG + Exonic
1060220639 9:121762422-121762444 TGACCAGCAGGCGACCTCCAGGG - Intronic
1060414996 9:123423971-123423993 TGAAGAGCTGGCAACCTGGAGGG + Intronic
1062494881 9:136827000-136827022 GGCACAGCAGGCCACCAGGAAGG - Intronic
1193621668 X:83760281-83760303 TGAACAGCAGGCAAGGCAGAAGG - Intergenic