ID: 904822840

View in Genome Browser
Species Human (GRCh38)
Location 1:33256497-33256519
Sequence TGAACAGCAGGCGACCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 53}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822826_904822840 24 Left 904822826 1:33256450-33256472 CCCGCCGCCGCCGCCGCCGCCGC 0: 182
1: 288
2: 633
3: 1353
4: 3315
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822834_904822840 5 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822830_904822840 17 Left 904822830 1:33256457-33256479 CCGCCGCCGCCGCCGCCTCGGCG 0: 3
1: 22
2: 316
3: 2257
4: 3967
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822827_904822840 23 Left 904822827 1:33256451-33256473 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822831_904822840 14 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822828_904822840 20 Left 904822828 1:33256454-33256476 CCGCCGCCGCCGCCGCCGCCTCG 0: 13
1: 258
2: 1794
3: 2744
4: 5254
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822835_904822840 2 Left 904822835 1:33256472-33256494 CCTCGGCGCTTGCAGAACCCAGA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822832_904822840 11 Left 904822832 1:33256463-33256485 CCGCCGCCGCCTCGGCGCTTGCA 0: 1
1: 0
2: 1
3: 9
4: 197
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822825_904822840 27 Left 904822825 1:33256447-33256469 CCTCCCGCCGCCGCCGCCGCCGC 0: 53
1: 298
2: 553
3: 1250
4: 3375
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53
904822833_904822840 8 Left 904822833 1:33256466-33256488 CCGCCGCCTCGGCGCTTGCAGAA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 904822840 1:33256497-33256519 TGAACAGCAGGCGACCCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822840 Original CRISPR TGAACAGCAGGCGACCCGGA AGG Intergenic