ID: 904822841

View in Genome Browser
Species Human (GRCh38)
Location 1:33256508-33256530
Sequence CGACCCGGAAGGTTTGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 12}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904822831_904822841 25 Left 904822831 1:33256460-33256482 CCGCCGCCGCCGCCTCGGCGCTT 0: 1
1: 0
2: 20
3: 144
4: 741
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822830_904822841 28 Left 904822830 1:33256457-33256479 CCGCCGCCGCCGCCGCCTCGGCG 0: 3
1: 22
2: 316
3: 2257
4: 3967
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822838_904822841 -5 Left 904822838 1:33256490-33256512 CCAGAAGTGAACAGCAGGCGACC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822833_904822841 19 Left 904822833 1:33256466-33256488 CCGCCGCCTCGGCGCTTGCAGAA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822832_904822841 22 Left 904822832 1:33256463-33256485 CCGCCGCCGCCTCGGCGCTTGCA 0: 1
1: 0
2: 1
3: 9
4: 197
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822837_904822841 -4 Left 904822837 1:33256489-33256511 CCCAGAAGTGAACAGCAGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822834_904822841 16 Left 904822834 1:33256469-33256491 CCGCCTCGGCGCTTGCAGAACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12
904822835_904822841 13 Left 904822835 1:33256472-33256494 CCTCGGCGCTTGCAGAACCCAGA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 904822841 1:33256508-33256530 CGACCCGGAAGGTTTGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904822841 Original CRISPR CGACCCGGAAGGTTTGCGCG CGG Intergenic