ID: 904823342

View in Genome Browser
Species Human (GRCh38)
Location 1:33258733-33258755
Sequence CTCAGGAAAGATTATGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904823342_904823347 29 Left 904823342 1:33258733-33258755 CCGCCATCATAATCTTTCCTGAG 0: 1
1: 0
2: 3
3: 27
4: 251
Right 904823347 1:33258785-33258807 GGTGTGGTGATTATCACATCAGG 0: 1
1: 0
2: 0
3: 3
4: 86
904823342_904823346 13 Left 904823342 1:33258733-33258755 CCGCCATCATAATCTTTCCTGAG 0: 1
1: 0
2: 3
3: 27
4: 251
Right 904823346 1:33258769-33258791 ACAGTTTTCACAGTATGGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 174
904823342_904823345 8 Left 904823342 1:33258733-33258755 CCGCCATCATAATCTTTCCTGAG 0: 1
1: 0
2: 3
3: 27
4: 251
Right 904823345 1:33258764-33258786 ACTTCACAGTTTTCACAGTATGG 0: 1
1: 1
2: 3
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904823342 Original CRISPR CTCAGGAAAGATTATGATGG CGG (reversed) Intronic
904823342 1:33258733-33258755 CTCAGGAAAGATTATGATGGCGG - Intronic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
909799105 1:79783171-79783193 CTTAGGAAAAATTATGTTAGAGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914694082 1:150059655-150059677 TTAAAGAAAGAATATGATGGTGG - Intergenic
915106252 1:153536651-153536673 CTGAGAAAAGATTTTGATGGAGG + Intergenic
919083071 1:192889783-192889805 CAAAGGAAAAATTATAATGGTGG - Intergenic
920950952 1:210571217-210571239 GTCAGGAAAGCTAATGATGTTGG + Intronic
922067970 1:222162534-222162556 CTCAGGAAAGATAAAGATGAAGG - Intergenic
922486549 1:225977548-225977570 GTCAGGAAAGAAAGTGATGGGGG + Intergenic
922992329 1:229924894-229924916 CTCAGGGAAGACTCTGAAGGCGG - Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1065158897 10:22898572-22898594 CTCGGGAAAGAGTGGGATGGTGG + Intergenic
1068774019 10:60852198-60852220 CCCAGAAGAGATGATGATGGAGG + Intergenic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1069523779 10:69149401-69149423 GTCAAGAAAGATGATGATTGAGG + Intronic
1070676166 10:78413025-78413047 CTCAGAAAAGAGTATGATATGGG + Intergenic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1073281663 10:102359096-102359118 CTCAGGTAGGAGTATGATGAAGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073722606 10:106190493-106190515 CTAAGGAAAGATTAAGATGCTGG + Intergenic
1074183172 10:111080165-111080187 CTATGTAAATATTATGATGGTGG + Exonic
1076503804 10:130958230-130958252 CCCAGGAAAGAATATGAGCGAGG - Intergenic
1080256408 11:30295518-30295540 CTCAGGAGAGGCTGTGATGGTGG - Intergenic
1081825225 11:46043989-46044011 CTGAGGAAAGGTTAAGATTGTGG + Intronic
1082799190 11:57401809-57401831 CCCAGGAAAGAATATGCTGAGGG + Intronic
1083792880 11:64997140-64997162 CTCTGGAAAGAGGATGGTGGAGG + Intergenic
1084606338 11:70174569-70174591 CTGAGGAAAGTTCATGTTGGAGG - Intronic
1086511381 11:87561853-87561875 CTCATGAAAAATCATGAAGGAGG - Intergenic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1089592701 11:119554859-119554881 CACAGGAGACATTTTGATGGTGG + Intergenic
1089899376 11:121964915-121964937 GTCAGGAAAAATTATGACAGGGG + Intergenic
1090795197 11:130129321-130129343 CTAAGGAAAGATGATGAGGGAGG + Intronic
1093547135 12:20361559-20361581 CCCAGGAAAGACTTGGATGGAGG + Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1095199667 12:39368653-39368675 CTAAGGAAAGTAAATGATGGTGG - Intronic
1095632349 12:44393192-44393214 CTTAGGAGAGCTTATGTTGGAGG - Intergenic
1095683319 12:45003889-45003911 CTTTGGAAAGAATGTGATGGTGG - Intergenic
1096330797 12:50710846-50710868 GTCAGGAAAGACTATGAAGAAGG + Intronic
1098012416 12:66067531-66067553 TTCAGGAAAGATTTTTATGAAGG + Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099666024 12:85630603-85630625 GTCAGGAAAGTTTATGAAGGAGG - Intergenic
1100272208 12:93037304-93037326 ACCAGGAAAGATTATGCTTGCGG + Intergenic
1100472780 12:94908596-94908618 CTCAGGAGGCATTTTGATGGTGG - Intronic
1101298784 12:103456060-103456082 CTCAGGAAAGTTTCTGAGGGTGG + Intronic
1102960266 12:117088252-117088274 ATCAGGAAAGATTTTGAGAGTGG + Intronic
1105574916 13:21641354-21641376 CTCAAGGAAAATTATTATGGTGG - Intergenic
1107077270 13:36336357-36336379 CTCTGGAAAGATTATGAAAAAGG + Intronic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1110887046 13:80653365-80653387 CTAAAGAAAGATTATTAAGGAGG + Intergenic
1111409071 13:87850860-87850882 CTCAAGAAGGATGATGATGGAGG + Intergenic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1114563921 14:23614334-23614356 CTCAGGAAAGAAGGGGATGGGGG + Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115038176 14:28886326-28886348 CAGAGGAAAGCTCATGATGGAGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1115769020 14:36651514-36651536 CTCAGGAAAGTATTTGAAGGAGG - Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1117221163 14:53607984-53608006 GACCGGAAAGATTATAATGGTGG + Intergenic
1117859186 14:60072239-60072261 TTGGGAAAAGATTATGATGGAGG + Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1122845513 14:104495242-104495264 CTAAAGTTAGATTATGATGGTGG + Intronic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1124424327 15:29550850-29550872 CTCAGGAAAGATGATGTGTGAGG - Intronic
1124498257 15:30201639-30201661 CGTATGAAAGATTATGATGTCGG + Intergenic
1128845971 15:70894983-70895005 CTCTAGAAACATTATAATGGTGG - Intronic
1128971724 15:72113699-72113721 ATCAGGAAAGATCTTAATGGTGG - Intronic
1130289877 15:82589390-82589412 ATAAGGAATGATTAGGATGGGGG - Intronic
1131527711 15:93165833-93165855 ACCAGGGAAGATTATGAGGGTGG - Intergenic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1132416298 15:101621790-101621812 CTCAAGAAAAATTATAATGTTGG - Intronic
1133611691 16:7439740-7439762 CTCAGGAAAGAATATGCATGAGG - Intronic
1134233533 16:12448003-12448025 CTTGGGAATGATGATGATGGTGG + Intronic
1134516291 16:14889793-14889815 CTCAGGAATGATTTTGGGGGAGG + Intronic
1134703963 16:16288445-16288467 CTCAGGAATGATTTTGGGGGAGG + Intronic
1134963580 16:18423669-18423691 CTCAGGAATGATTTTGGGGGAGG - Intronic
1134967875 16:18506268-18506290 CTCAGGAATGATTTTGGGGGAGG - Intronic
1136747816 16:32607356-32607378 CTCAGGTCAGATTAGGAAGGAGG + Intergenic
1136748057 16:32609614-32609636 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1138374899 16:56556478-56556500 ATCAGGAAAGATTACGCAGGGGG + Intergenic
1140186740 16:72780268-72780290 CTCAAGAAATAGTGTGATGGGGG + Intergenic
1203049951 16_KI270728v1_random:866563-866585 CTCAGGTCAGATTAGGAAGGAGG + Intergenic
1203050194 16_KI270728v1_random:868821-868843 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1143245283 17:5479691-5479713 CTGATGAAAGTTTCTGATGGTGG - Intronic
1146524072 17:33551278-33551300 TTCCGGAAAGATTCTGGTGGTGG + Intronic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1147332671 17:39708108-39708130 ATCAAGAAAGATAATGGTGGGGG - Intronic
1148072289 17:44915417-44915439 CTCAGGGGAGATGATGGTGGGGG - Exonic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1149364840 17:55933016-55933038 CTCTGGAAAGAATATGTAGGTGG + Intergenic
1154474149 18:14736802-14736824 CTCAGGAAAGGCTCTGATAGAGG + Intronic
1155700723 18:28739584-28739606 ATCAGGAAAAATTTTCATGGTGG + Intergenic
1161878989 19:6933890-6933912 CTCAGGAATGCTTTTGAGGGAGG + Intronic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
926047145 2:9718000-9718022 CTTAGGATTGATTATGATGGAGG + Intergenic
926170086 2:10547668-10547690 TTCAGGAAAGCTGATGATGGAGG - Intergenic
926705012 2:15830935-15830957 ATAAGGAAAGATTATAAGGGTGG + Intergenic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929807746 2:45162131-45162153 CCCAGGAGAGATTCTGAGGGAGG + Intergenic
930710475 2:54546324-54546346 TTCAGGATAGTTGATGATGGGGG + Intronic
931027675 2:58131562-58131584 CTAAGGAAAGATGAAGTTGGAGG + Intronic
932922557 2:75933812-75933834 CTCAGGAAAGTTTAGGATGGTGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
939147132 2:138429224-138429246 CTCAGGAAACATGATCATAGTGG - Intergenic
940046235 2:149413252-149413274 CCCAGGAGAGACTAAGATGGGGG + Intronic
940660474 2:156539082-156539104 CTGAGGAATGTTTATGATTGAGG + Intronic
940702713 2:157065933-157065955 ACAAGGAAAGATTATGAAGGAGG + Intergenic
940849351 2:158673364-158673386 CTCAGTAAAGATTCGGAGGGAGG + Intronic
941277955 2:163514444-163514466 CTGAGGAAAGATCTTAATGGAGG + Intergenic
941516939 2:166491866-166491888 CTCCTGAAAGCTTATGGTGGAGG - Intronic
941524761 2:166593083-166593105 CTTAGGAAACACTATTATGGTGG - Intergenic
942547862 2:177083471-177083493 CTCAAGACAAATTGTGATGGAGG + Intergenic
944687037 2:202126598-202126620 CTCAGTAAAAATGATGATGATGG + Intronic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
946740612 2:222797443-222797465 TGCAGGAAAGATTATTTTGGGGG - Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
1168885316 20:1247843-1247865 CTTAGGAAAAATTATGAAGTAGG + Intronic
1169497320 20:6127773-6127795 GTCAGGAATGACTATGGTGGTGG + Intergenic
1169697747 20:8409875-8409897 CACAGGAAAGAAGATGCTGGGGG + Intronic
1171328829 20:24319174-24319196 CTGAGGAAAGATGATGCTGCAGG - Intergenic
1172011826 20:31850169-31850191 CCCAGCAAAGATTTTGATGCAGG + Intronic
1172453746 20:35049097-35049119 CTCAGGACAGATTAGGACTGGGG + Intronic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1175596915 20:60242442-60242464 CTCAGGATAGATTAAGACAGTGG + Intergenic
1177285468 21:19042867-19042889 CTCAGGAAACATCATCTTGGAGG + Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1179009543 21:37545815-37545837 CAAAGGAAAGTGTATGATGGGGG - Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1182376254 22:29850570-29850592 CTCATAAAAGAATTTGATGGAGG - Intergenic
1183980624 22:41537736-41537758 CTCAGGACAGATGAGGGTGGGGG + Intronic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
950002053 3:9664356-9664378 CTGAGGAACTAGTATGATGGTGG + Intronic
950509540 3:13417894-13417916 CTCAGAAAAGAAAATGATGTTGG + Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
953367619 3:42359492-42359514 CTGAGTAATGATTTTGATGGTGG - Intergenic
953657505 3:44865202-44865224 AGCTGGAAAGATCATGATGGTGG + Exonic
954342999 3:49970812-49970834 CTCAGGAGAGAATGTGAGGGTGG + Intronic
954835491 3:53463521-53463543 CTCAAGAAAGATGTTAATGGAGG - Intergenic
954907134 3:54072361-54072383 CTCGGGAAAGATTCTGAGTGTGG - Intergenic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957902291 3:86510286-86510308 CTTAGGATAGATAATGATGATGG + Intergenic
958951496 3:100421816-100421838 CTCAGAAAAGAATGTTATGGAGG + Intronic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
963067956 3:141278765-141278787 CTCACTAAAGATCATGATGATGG - Intronic
963446745 3:145420905-145420927 CACAGAAAAGATGATGATAGAGG - Intergenic
965100307 3:164289597-164289619 CTCAGGAAATACGATCATGGCGG + Intergenic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966249112 3:177842297-177842319 CTCAGGAAAGATTTGGCTAGAGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
968951989 4:3700114-3700136 CTCAGCAAAGACAAAGATGGAGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969938053 4:10702610-10702632 CTCAGGAAAGAGCATTCTGGAGG + Intergenic
970129120 4:12847062-12847084 TTCAGAAAATATTATGATGATGG + Intergenic
970363996 4:15340257-15340279 CCCAGGAAATATTTTGATGAAGG - Intronic
971147021 4:23988434-23988456 GTCAGGAAAGAACATGCTGGGGG - Intergenic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
974716385 4:65672927-65672949 ATCAGAAAAGGTAATGATGGTGG + Intergenic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
975748874 4:77502174-77502196 CTCAGGAAATATTATTTTGTAGG - Intergenic
976841726 4:89439782-89439804 ATCAGGGAAGATTTTGAGGGAGG + Intergenic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
982307666 4:153950452-153950474 CTAAAGAAAGCTTATGAGGGAGG + Intergenic
982578489 4:157147450-157147472 TTCAGGAAAGAAGATGAGGGGGG + Intronic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984839524 4:184055308-184055330 ATTAAGAAAGATTATGTTGGGGG + Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
988598552 5:32617865-32617887 CTCTGGCAAGGCTATGATGGGGG + Intergenic
989112279 5:37917736-37917758 CTCATGAAAAAATATGAAGGGGG + Intergenic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989270798 5:39530652-39530674 CTCAGGAAAGATTATGAAGCTGG + Intergenic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
994153992 5:96481767-96481789 CACAGAAAAGATTAAGTTGGTGG + Intergenic
995221367 5:109652497-109652519 CTCAGGCAAAATTATGAAGTAGG + Intergenic
996631126 5:125633789-125633811 GTCAGGAAAGATAAAGATAGGGG + Intergenic
997515653 5:134487498-134487520 CTCTGGAAAGGATATGATGTTGG + Intergenic
998916581 5:147018871-147018893 CTCAGAACAGAAGATGATGGTGG + Intronic
998966404 5:147545595-147545617 CTCAGCAAAGAGCATGAAGGTGG - Intergenic
999796316 5:154992899-154992921 CTCTGGAAAGATAAAGATAGTGG + Intergenic
1000642578 5:163720101-163720123 CTCAAGATAGATTCTGATGATGG + Intergenic
1001988081 5:176092935-176092957 CTCAGGTCAGATTAGGAAGGAGG + Intronic
1001988737 5:176098173-176098195 CTCAGGTCAGATTAGGAAGGAGG + Intronic
1001989290 5:176102966-176102988 CTCAGGTCAGATTAGGAAGGAGG + Intronic
1002227581 5:177735172-177735194 CTCAGGTCAGATTAGGAAGGAGG - Intronic
1002228131 5:177739963-177739985 CTCAGGTCAGATTAGGAAGGAGG - Intronic
1002228787 5:177745205-177745227 CTCAGGTCAGATTAGGAAGGAGG - Intronic
1002266559 5:178038578-178038600 CTCAGGTCAGATTAGGAAGGAGG + Intronic
1003914592 6:10774901-10774923 TTCAGGAAAGATTCAGATGGAGG + Intronic
1005145991 6:22690627-22690649 CTGAGGAAAGATTATGAATGTGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1007586184 6:42991221-42991243 TTCAGGAATGATTATAATTGTGG + Intronic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1009803738 6:68575251-68575273 CTTAGGAAAGAGTTTGTTGGTGG + Intergenic
1010630288 6:78190466-78190488 CTCAGGAGAGAGGAAGATGGGGG - Intergenic
1011455071 6:87539889-87539911 CTCATGAAAGATTAAGCTTGAGG + Intronic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011897838 6:92254048-92254070 CTCAAGAGAGATTATCCTGGCGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1013616361 6:111846873-111846895 ATCAGGAAAGATAAGGATAGAGG + Intronic
1013967476 6:115972163-115972185 CCCAGGAAAGCTTCTGCTGGAGG - Intronic
1014604417 6:123454537-123454559 CTCAGGAAAGATGACGAATGTGG + Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015268668 6:131316464-131316486 TTCATGTAAAATTATGATGGTGG + Intergenic
1015726540 6:136305289-136305311 CTCAGGAAAGATACTAATGCTGG + Intergenic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1018514060 6:164558959-164558981 GTCATGAAAGAGAATGATGGAGG - Intergenic
1021779656 7:24090398-24090420 CTCAGGGAATATAATGGTGGTGG + Intergenic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1028069635 7:86435304-86435326 CTCAAGAAAGTTTATGTTGAGGG + Intergenic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1032752978 7:134860817-134860839 CTCAGGAAAGGGTATCATGAGGG + Intronic
1033101435 7:138476260-138476282 CTCATGAAAGATGATTATTGAGG + Intronic
1033217745 7:139505902-139505924 CTCGGGAAGGGTTTTGATGGCGG - Intergenic
1033845519 7:145427342-145427364 CTCAGGAAAGACAATAACGGAGG - Intergenic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1038433083 8:27515474-27515496 TTCTGCAAAGATTATGATGTTGG - Intronic
1039570723 8:38584192-38584214 CTTTGGAAAAATTATGATAGAGG + Intergenic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1044468829 8:92541143-92541165 TTCAGAAAAGATTATGATGGTGG + Intergenic
1045997997 8:108385866-108385888 CTCAAGAAAGCCTATGATGTAGG + Intronic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046676708 8:117116708-117116730 CTGAGAAAAGACTTTGATGGTGG - Intronic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047768334 8:128008665-128008687 CTCAGTAATGATTATAATGGTGG + Intergenic
1047882327 8:129209706-129209728 CTCAGTATAGGTTTTGATGGTGG - Intergenic
1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG + Intronic
1050084238 9:1947880-1947902 CTCATCACAGATGATGATGGGGG - Intergenic
1050516919 9:6454353-6454375 ATTAGGAAAGATGATGATTGAGG + Intronic
1051183436 9:14435297-14435319 CACAGCAAAAATTATGAAGGTGG - Intergenic
1051754533 9:20383707-20383729 TTCAGGGAAGACTATCATGGGGG - Intronic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1058085184 9:100740583-100740605 CTCATGAGAGATTACCATGGTGG - Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1060223942 9:121780272-121780294 CTGAGGAAAGCTTGTGCTGGGGG - Intronic
1061418340 9:130460205-130460227 CACAGCTAAGATGATGATGGAGG + Intronic
1186621351 X:11243712-11243734 GTCTGAAAAGATTATAATGGAGG + Intronic
1187973538 X:24682562-24682584 CACAGGACAGATTGTGAAGGAGG + Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1189680711 X:43513127-43513149 CTCAGCAAAGATGGTAATGGTGG + Intergenic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1194643892 X:96434699-96434721 CAGAGGAAAGATAATGATGAGGG + Intergenic
1195042727 X:101028932-101028954 CTCAGGACACACTATCATGGTGG - Intronic
1195760537 X:108241272-108241294 CTCAGAAAAGCTTATGAAGTAGG + Intronic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1200915296 Y:8566119-8566141 CTCAGGAAAGATAAAAAGGGGGG - Intergenic
1201608571 Y:15815297-15815319 CTCAGGAATGATAAACATGGTGG + Intergenic