ID: 904824263

View in Genome Browser
Species Human (GRCh38)
Location 1:33264390-33264412
Sequence CAGCTGCCATTGCTGTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904824263_904824265 7 Left 904824263 1:33264390-33264412 CCTAGCAACAGCAATGGCAGCTG 0: 1
1: 0
2: 1
3: 37
4: 258
Right 904824265 1:33264420-33264442 AGGAGTCCTCACTGTGTGTCAGG 0: 1
1: 0
2: 1
3: 48
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904824263 Original CRISPR CAGCTGCCATTGCTGTTGCT AGG (reversed) Intronic
902252786 1:15166296-15166318 CAGCTGCCACTCCTGGTGGTTGG + Intronic
902711820 1:18245736-18245758 CTGCTGCTGTTGCTGCTGCTTGG + Intronic
902775910 1:18674847-18674869 ATGCTGCCACTGCTGTTGGTGGG - Intronic
903344956 1:22677992-22678014 CAGCTGCTATTGTTATTACTTGG + Intergenic
904066996 1:27760600-27760622 CAACTCCATTTGCTGTTGCTAGG - Intronic
904824263 1:33264390-33264412 CAGCTGCCATTGCTGTTGCTAGG - Intronic
905304453 1:37007860-37007882 CACCTCCCACTGCTGCTGCTCGG - Intronic
905656583 1:39689894-39689916 CTGCTGCTATTGCTGCTGCTTGG - Intronic
906249148 1:44297898-44297920 TAGCTGCTGTTGCTGCTGCTTGG - Intronic
906589920 1:47015383-47015405 CAGCTGCTATGGTTATTGCTGGG - Intergenic
907623462 1:56006043-56006065 CAGCTTCCAATGCTCTTGCAGGG - Intergenic
908416988 1:63923008-63923030 CAGCTTCCTGTGCTGTTGGTAGG + Intronic
909047491 1:70728004-70728026 TAGCTGCCATTTCTGTGGTTAGG - Intergenic
912632362 1:111256695-111256717 CAGCTGCTCTTGCTGTAACTGGG + Intergenic
915041522 1:152971898-152971920 CTGCTGCCGCTGCTGCTGCTGGG - Exonic
915356203 1:155256303-155256325 CAGCTGCCAATGCAGCCGCTGGG - Exonic
915763239 1:158336528-158336550 CACCTGCCATTGCTGAGGCTTGG + Intergenic
916508181 1:165446706-165446728 GAGCTGCCTTGACTGTTGCTGGG + Intergenic
917436935 1:175031546-175031568 CAGCTGCCATTCCTTTTGCCTGG - Intergenic
919819319 1:201462985-201463007 CAGCTTCCGTTTCTCTTGCTAGG - Intergenic
920571667 1:207022543-207022565 CAGCAGCTATTCCTGCTGCTGGG - Exonic
921249513 1:213283262-213283284 CTGCTGCTCCTGCTGTTGCTGGG + Intergenic
921625486 1:217373826-217373848 CAGCTTCCATGGCTGGTGCGGGG - Intergenic
924854707 1:247864769-247864791 CAGCTGCCGTTGCTCCTCCTGGG - Exonic
1065195592 10:23262138-23262160 CATCTGCCAGTGCTGCTGCCTGG - Intergenic
1065320800 10:24507560-24507582 CAGTTTCCATTGCTGTTTTTAGG - Intronic
1067421787 10:46158603-46158625 CAGCTTCCATGGCTGTTACAAGG + Intergenic
1067507093 10:46864692-46864714 CAGCTTCCATGGCTGTTACAAGG + Intergenic
1069295030 10:66833130-66833152 GATCTGCCATTCATGTTGCTAGG + Intronic
1070438947 10:76423668-76423690 CTGCTGCTATTGCTGCTGTTTGG + Intronic
1070831584 10:79421196-79421218 CAGCTGGGATGGGTGTTGCTGGG - Intronic
1071011496 10:80945327-80945349 CTGCTGCCATTGCTGCTGCCAGG + Intergenic
1071549597 10:86556510-86556532 CAGCTGTCATTGCATTTGCCTGG - Intergenic
1072102315 10:92240282-92240304 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1072323631 10:94274800-94274822 CAGGTGACCTTGCTTTTGCTTGG + Intronic
1072522101 10:96238007-96238029 CAGCTGGCATTGCTGTGGGAAGG - Intronic
1074657293 10:115606298-115606320 CAGCTGCCAAAGCTGTTAATGGG + Intronic
1075455357 10:122581473-122581495 CAGACGCCATTGCTGAAGCTCGG - Intronic
1075457479 10:122594176-122594198 CAGACGCCATTGCTGAGGCTCGG - Intronic
1075458550 10:122600672-122600694 CAGACGCCATTGCTGAGGCTCGG - Intronic
1075861324 10:125679226-125679248 CAGCTGCAGCTGCTGGTGCTGGG - Intronic
1076083481 10:127605081-127605103 CACCTGCCCTTTCTGTTTCTGGG + Intergenic
1076180251 10:128401626-128401648 CAGCTGCCATAGCTGCTGCCAGG - Intergenic
1076273751 10:129178751-129178773 CAGCAGTCCTTGGTGTTGCTTGG + Intergenic
1076557939 10:131341693-131341715 TCTCTGCCATTCCTGTTGCTTGG - Intergenic
1076982447 11:211943-211965 TCGCTGCCACTGCTGGTGCTGGG + Intronic
1077103314 11:831640-831662 CTGCTGCTGCTGCTGTTGCTGGG + Exonic
1078726009 11:13931557-13931579 AACCTCCCATTGCTGTTCCTTGG - Intergenic
1079091267 11:17481951-17481973 CAGCTGCCACTGCTGATGGAAGG + Intergenic
1079992698 11:27263220-27263242 CAGCTTCCAGTGCTGTTTATTGG - Intergenic
1080290161 11:30661968-30661990 CAAATGCCATAGCTCTTGCTTGG - Intergenic
1081569240 11:44279331-44279353 CAGTTCCCACTGCTGTTCCTCGG + Intronic
1083792409 11:64994523-64994545 CAGCTGCCTTTGTTGCTCCTTGG + Exonic
1083864652 11:65446882-65446904 CTGCTGCCCTTGCAGTTGCAGGG - Intergenic
1085254178 11:75163111-75163133 CAGCTGCCCTTGGTGGAGCTAGG - Intronic
1086820752 11:91433477-91433499 CAGCTGCCATTTCTGTGGTTAGG - Intergenic
1087448827 11:98291608-98291630 CTGCTGCTATTGCTGTCGGTTGG - Intergenic
1087475118 11:98624266-98624288 CTGCTAGCATTGCTGTGGCTGGG + Intergenic
1088352234 11:108903015-108903037 CAGCTGGGATTGTAGTTGCTGGG - Intronic
1089088092 11:115841047-115841069 CACCTGCAATTGCAGCTGCTTGG - Intergenic
1089123773 11:116161843-116161865 TAGCTTCCATTGCTCTTGATGGG - Intergenic
1093521569 12:20057360-20057382 CTGTTGCCATTGATGTTGCTAGG - Intergenic
1093649556 12:21627274-21627296 CATCCGCCATTGCTGAGGCTTGG - Intergenic
1095832642 12:46604096-46604118 CTGCTGACACTGCTGCTGCTGGG + Intergenic
1097334276 12:58364920-58364942 CAGCTGCCTTTACTGTTGAGTGG + Intergenic
1098166012 12:67698760-67698782 CAGTAGTCATTGCTGTTGCCTGG + Intergenic
1098914878 12:76246852-76246874 CAGCTGCCACTGCTGTGGTTGGG - Intergenic
1100740053 12:97581710-97581732 CATCTGCCATTACTGAGGCTTGG + Intergenic
1103415066 12:120738027-120738049 CTGCTGTCATTTCTGTTTCTAGG + Intronic
1103434515 12:120914587-120914609 CAGCTCCCATTCCTGCTGCATGG + Intergenic
1103700594 12:122847027-122847049 CAGCTGCCCTGGCTGAGGCTGGG + Intronic
1104288838 12:127449872-127449894 CAGCTGCCAGTGCTGAGTCTGGG - Intergenic
1104365418 12:128172399-128172421 CAGCTTCCAGTGCTGCTGTTGGG - Intergenic
1104821099 12:131678055-131678077 CATCGGCCGCTGCTGTTGCTGGG + Intergenic
1105472769 13:20706885-20706907 CAGCTGCCACTCCTGCTCCTGGG - Intronic
1105605339 13:21922012-21922034 CAGCTTCCTTTGCAGTTCCTGGG - Intergenic
1106012428 13:25837684-25837706 CAGCTTACCTAGCTGTTGCTGGG + Intronic
1106573910 13:30956746-30956768 CAGCTGCCACTGCAGGTGCATGG - Intronic
1106723034 13:32455452-32455474 CAGCTGCCACTGCTGCTGCAGGG + Intronic
1108478867 13:50846744-50846766 CTGTTGCCATTGCTGATGCTTGG - Intergenic
1110930567 13:81211146-81211168 CAGCTGCCATGGGTATTGATAGG - Intergenic
1112255985 13:97831626-97831648 CCGCTGACAATGCTCTTGCTGGG + Intergenic
1112748649 13:102556356-102556378 CAGCTGCCGTTGATGTTTATTGG - Intergenic
1113591091 13:111501807-111501829 CACCCGCCATTGCTGAGGCTTGG - Intergenic
1114181644 14:20373098-20373120 CAGCCGTCACTGCTGTGGCTTGG - Exonic
1114731149 14:24993961-24993983 CAGCTGCCATCCCTGCAGCTGGG - Intronic
1116869851 14:50060592-50060614 CAACAGCCCTTGCTGTAGCTAGG - Intergenic
1118822036 14:69352131-69352153 CAGCTGCCACTGCTGGGCCTGGG - Exonic
1119184463 14:72630096-72630118 GTGCTGCCATAGCTGATGCTGGG - Intronic
1119975795 14:79022683-79022705 CAGCAGCATTTGGTGTTGCTTGG + Intronic
1120178053 14:81316190-81316212 CACCTGCCATTTCTGTTGCTTGG - Intronic
1121742337 14:96263014-96263036 CAGCTTCCTTTGCTGTTCCCGGG + Intronic
1122573701 14:102726802-102726824 GAGCTGCCATTGGTGGGGCTCGG - Exonic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1125342442 15:38688292-38688314 CATCAGCCATTACAGTTGCTTGG + Intergenic
1126599836 15:50417648-50417670 CAGCTGCCATTGCCAAGGCTGGG + Intergenic
1127332397 15:57951772-57951794 CAGCCTCCATTTCTTTTGCTGGG + Intergenic
1127665686 15:61144494-61144516 CAGCTGCCATGACTGTTAGTAGG + Intronic
1128740427 15:70079748-70079770 CAGCGGTCATTACTGTTGTTAGG - Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1130381732 15:83377857-83377879 CACCTGCCATTCCTGCTGCATGG + Intergenic
1132085677 15:98906596-98906618 CAGCTGGCGCTACTGTTGCTGGG - Intronic
1133346146 16:5071889-5071911 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1133853140 16:9524783-9524805 AAGCTGTCATTCCAGTTGCTTGG + Intergenic
1134040831 16:11067081-11067103 CAGTTGCCACTACTGTTTCTTGG - Intronic
1135169411 16:20169960-20169982 CAGCAGTCATTGGTGTTTCTTGG + Intergenic
1135375510 16:21943741-21943763 CAGCTGCCATCTCTGTGGTTTGG - Intergenic
1136777216 16:32878468-32878490 AAGCTGCCACTGCTGCTTCTGGG + Intergenic
1136893407 16:33983045-33983067 AAGCTGCCACTGCTGCTTCTGGG - Intergenic
1137580438 16:49630547-49630569 CCGCAGCCATTGCTGCTGGTTGG - Intronic
1137749502 16:50849066-50849088 CAACTGCTAATGCTGTTGGTAGG - Intergenic
1141701019 16:85642060-85642082 CAGCTGGCATCGCCGTTGGTGGG + Intronic
1203079630 16_KI270728v1_random:1140577-1140599 AAGCTGCCACTGCTGCTTCTGGG + Intergenic
1143696703 17:8625820-8625842 CTGCTGCCACTGCTGGTCCTGGG + Intronic
1149133760 17:53340314-53340336 CATCTGCCACTGCTGGGGCTTGG + Intergenic
1150625779 17:66840261-66840283 CAGATGGCATTGCTGCAGCTCGG - Intronic
1151380912 17:73725227-73725249 CATCTGCAATTGCTGTCACTGGG - Intergenic
1151994850 17:77602096-77602118 GAGCTGCCATTGCTCAGGCTGGG - Intergenic
1155032085 18:21993565-21993587 CAGCAGCTACTTCTGTTGCTTGG + Intergenic
1157554912 18:48607149-48607171 CAGCTGCCTCTGCCTTTGCTTGG - Intronic
1158905083 18:62004066-62004088 CAGCTGCCATTGTTCTTCCAGGG + Intergenic
1158991732 18:62875559-62875581 CAGAGGTCATTACTGTTGCTAGG + Intronic
1159657721 18:71052608-71052630 CAGCTGCCATCCCTGGTGCTGGG + Intergenic
1159741394 18:72175532-72175554 CTGCTGCTATTGCTGTTGGTTGG + Intergenic
1160092040 18:75836618-75836640 CAGCTGGCATTGCTGTGGGCAGG - Intergenic
1160672398 19:372407-372429 CAGCTGGCAATGCAGTTGCACGG + Intronic
1161106267 19:2445434-2445456 CAGCTGCCAATGTGGTGGCTCGG + Intronic
1161955867 19:7494684-7494706 CAGCTGGCCTTGGTGTTGCTAGG + Intronic
1161958873 19:7512012-7512034 CATCTTCCTTTGCTGTTGCTTGG - Intronic
1162010639 19:7811902-7811924 CAGCTGGCTTTGGTGTTGTTAGG - Intergenic
1162010683 19:7812435-7812457 CAGCTGGCTTTGGTGTTGCTAGG - Intergenic
1168623575 19:57898484-57898506 CAGCTCCCATTCCTCTTGTTTGG + Intronic
925286812 2:2721460-2721482 TAGGTGCCAGTGCTGTGGCTGGG - Intergenic
926636165 2:15181993-15182015 GAGCTCCCATTGCTGTTGCCTGG + Intronic
927225113 2:20756985-20757007 CAGCTGCTAATGGTGTTGATAGG + Intronic
927822376 2:26279196-26279218 CCGCTGCCTTTGCTGTTTCTCGG + Exonic
929487136 2:42364805-42364827 CAGCTGGGATTGCAGTTGCCGGG + Intronic
929786389 2:44996343-44996365 CAGCTTCCCTTGCAGTTGGTTGG + Intergenic
932186286 2:69699108-69699130 CCACTGCCAGTGCTGGTGCTTGG - Intronic
932379584 2:71269922-71269944 CAGCTGCCATCTCTGTGGTTTGG + Intergenic
934860241 2:97758820-97758842 CATCTGCCATTGCTGTGACATGG - Intronic
934972953 2:98777885-98777907 CAGCTCCCAGTGCTGATGCAGGG - Intergenic
935929917 2:108113284-108113306 CAGCTGCCATCTCTGTGGTTTGG - Intergenic
936227152 2:110666209-110666231 AAACTGCCATTCCTGCTGCTGGG + Intronic
936656096 2:114489398-114489420 CAGCTGCATTTGCTGTAGCCAGG + Intronic
937157190 2:119729521-119729543 GAGCTGCCATTGGGGTTTCTAGG + Intergenic
938073820 2:128321712-128321734 GAGCTGCCAGTGCTTTTCCTTGG - Intergenic
939914435 2:148021505-148021527 CTGCTGCTACTGCTGCTGCTTGG + Intronic
941817528 2:169812664-169812686 AAGCTGCCATGGCTAATGCTAGG - Intronic
941856405 2:170235407-170235429 CAACTGCCATTCCAGTTACTTGG - Intronic
942763976 2:179432154-179432176 CTGCTGCTACTGCTGCTGCTTGG + Intergenic
942890635 2:180982079-180982101 GAACTGCCACTGCTGGTGCTGGG - Exonic
944522642 2:200587316-200587338 CAGGTGCCACTGCTCTTGCTTGG - Intronic
947175766 2:227366117-227366139 CAATTGGCATTACTGTTGCTTGG + Exonic
947668671 2:231923224-231923246 CAGCTGTCTGTGATGTTGCTGGG + Intronic
948040410 2:234896982-234897004 GAGGTGCAATTGCTGTTTCTTGG - Intergenic
948704758 2:239782008-239782030 CAGCAGCCCTTGGTGTTCCTTGG - Intronic
1168753851 20:302080-302102 CATCTGCTATTTCTGCTGCTTGG - Intergenic
1169860343 20:10144695-10144717 CAGCTGCCATTACTGCAGCAAGG - Intergenic
1170876755 20:20256952-20256974 CAGCTGCCATTTCAGGGGCTGGG + Intronic
1172066312 20:32223168-32223190 CAGCTGGCTTTCCTGCTGCTGGG - Intronic
1173502516 20:43564388-43564410 CAGCTGCCATGGCTGATGTCTGG + Intronic
1174416837 20:50373028-50373050 CAGCTGCCATCTCTGTGGCATGG + Intergenic
1174684307 20:52438786-52438808 CTGCTGGCCTTGCTGTTTCTGGG - Intergenic
1175452014 20:59077500-59077522 CACCTGCCATTGCTGCCCCTGGG + Intergenic
1175806509 20:61832082-61832104 CAGCTGCCATGGCTGGAGGTTGG - Intronic
1178092351 21:29178131-29178153 CATCTTCTATTGCTGTTGCTCGG - Intergenic
1178506685 21:33168611-33168633 CAGCCCCCATTGCTGTTACTTGG - Intronic
1179576938 21:42313653-42313675 CAGCTGCCAGAGCCCTTGCTGGG + Intronic
1181326097 22:22047533-22047555 CAGCTGCCATTTGTGTTTTTGGG + Intergenic
1183098536 22:35569224-35569246 CAGCTGACAGTGCTGTTGTGAGG - Intergenic
1183263578 22:36811903-36811925 CAGCTGCCCTTCTTGTGGCTGGG - Intronic
1183383272 22:37501220-37501242 CTGCTGCCCATGCTGTTCCTGGG - Intronic
1184298975 22:43543759-43543781 TTGCTGCCTTTGCTGGTGCTGGG - Intronic
950257481 3:11517702-11517724 CATGTGCCATTTCTGTGGCTTGG - Intronic
951919839 3:27842289-27842311 CAGCCACCATTGCTGCTGTTGGG + Intergenic
952852606 3:37741289-37741311 GAGCTGCTGTTGCTGCTGCTGGG - Intronic
953870914 3:46627053-46627075 AAACTGCAAATGCTGTTGCTGGG + Intergenic
956967270 3:74476412-74476434 CAGCTGTTATTGCTGCTGCCAGG - Intronic
958817114 3:98928376-98928398 CAGCTGCCATTTCTGCAGTTCGG + Intergenic
959175753 3:102907767-102907789 CTGCTGCCATTTCTGGTGATTGG - Intergenic
959815815 3:110671889-110671911 CGTCTGCCATTGCTGAGGCTTGG + Intergenic
960338697 3:116448410-116448432 CTGTTTCCATTGCTGGTGCTAGG + Intronic
961917484 3:130392365-130392387 CAGCTACCATTGGGGTTGGTAGG + Intronic
962428638 3:135298567-135298589 CAGCTGGCATGGCTGGTGATGGG + Intergenic
963733343 3:148992433-148992455 CAGCTGTCATTGGTCTTTCTTGG + Intronic
964988251 3:162771959-162771981 CAACTGCCATCACTGTTGCTTGG - Intergenic
965674116 3:171176710-171176732 CTGCTGCCATTGCAGCAGCTGGG + Intronic
966840251 3:184082136-184082158 CAGCTTCCATGGCTGCTGCCAGG - Intergenic
967181492 3:186909355-186909377 CATCCGCCATTGCTGAGGCTTGG - Intergenic
968083699 3:195864268-195864290 CAGCTTCCAGTGGTGTTGCCTGG - Intronic
968768789 4:2489863-2489885 CAGCTGAGACTTCTGTTGCTGGG - Intronic
969415019 4:7052406-7052428 CAGAGGCCATTGCGGTTCCTGGG + Intronic
970419382 4:15891100-15891122 CATCTCCCAGTGCTGTTGCATGG + Intergenic
970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG + Intergenic
970651797 4:18186962-18186984 CAGCTACCATTGCTCATGTTTGG + Intergenic
970991063 4:22213859-22213881 CAGTTTAGATTGCTGTTGCTTGG + Intergenic
972185982 4:36529206-36529228 CTGCTGCAATTGCTGTTAGTTGG + Intergenic
972501406 4:39681275-39681297 CTGTGGCCATTGCTGTTTCTAGG + Intergenic
972664539 4:41151687-41151709 CAGCTTCCATTGTTGCTGTTGGG + Intronic
975764695 4:77655067-77655089 CAGCTGCCATCACTGAGGCTTGG + Intergenic
976381248 4:84401812-84401834 CTGCTGCCAGTGTTTTTGCTTGG + Intergenic
976764682 4:88587353-88587375 CAGCTGATTTTGCTTTTGCTTGG + Intronic
977416654 4:96742618-96742640 CAGCTGGCATTGCTGGCCCTGGG + Intergenic
981831908 4:149011426-149011448 CAGCAGCCATTGCTGCTCCTTGG - Intergenic
982275175 4:153630789-153630811 AGGCTGCCATTGTTGTTGCCTGG - Intronic
983472505 4:168174208-168174230 CAGCTACTTTTCCTGTTGCTTGG - Intronic
983720090 4:170840121-170840143 TAGCTGCCATTGCTGAACCTTGG - Intergenic
983724501 4:170903623-170903645 CAGCTGTCTTTGCTGTTGAGTGG + Intergenic
984819881 4:183872662-183872684 CATATGACATAGCTGTTGCTAGG + Intronic
985522925 5:387327-387349 TAGCTGCCATTCCTGCTGCATGG + Intronic
985539323 5:480548-480570 GAGCTGCCATTGCTGCCGCGGGG - Intronic
986694510 5:10339844-10339866 CGGCTGCCATTCCTAGTGCTTGG + Intergenic
988381268 5:30499534-30499556 CATCTGCCATTGCTGAGGCTTGG - Intergenic
990719537 5:58678062-58678084 GAGCTTCCATGGCTGTTCCTAGG - Intronic
990923371 5:60993220-60993242 CAGCTTCCATAGCTGTCACTGGG + Intronic
992408730 5:76484314-76484336 CAGCTGCCATTGCAGATGTGGGG + Intronic
992677812 5:79123315-79123337 CAGGTGTCTTTGCTGTTGCTGGG - Intronic
993493977 5:88586791-88586813 CAGCTGCCATCTCTGTGGATTGG + Intergenic
997127608 5:131243894-131243916 TGGGTTCCATTGCTGTTGCTGGG - Intergenic
997484247 5:134215932-134215954 CAGCTGGCCTTGCTGTTGAATGG - Intronic
998734819 5:145124990-145125012 CAGCTGCCACAGAAGTTGCTGGG - Intergenic
1000366934 5:160500503-160500525 AAGATGCCACTGCTGCTGCTTGG - Intergenic
1000851798 5:166349389-166349411 CAGCTGCTGTTTCTGATGCTTGG - Intergenic
1001131986 5:169071953-169071975 AAGCTCCCTTTGATGTTGCTTGG + Intronic
1001753029 5:174145981-174146003 CAGATGCTGATGCTGTTGCTAGG + Intronic
1002469938 5:179429116-179429138 CAGCTGCCAGTGCAGCTGCCTGG - Intergenic
1003123525 6:3337322-3337344 GAGCTGCCAGTGGTGCTGCTGGG + Intronic
1004573987 6:16874716-16874738 CACCTGCCATTTCTGTTCCCAGG - Intergenic
1006421495 6:33936826-33936848 CAGCTTCCCTTGCTGCTGCTAGG + Intergenic
1006871752 6:37257905-37257927 CAGCGGCCATTGCTCTGGCCGGG - Exonic
1010074797 6:71787137-71787159 CAGGGGCCATTGCAGTTTCTTGG + Intergenic
1010686132 6:78857157-78857179 CAGCTCCCATTCCTCTTGTTTGG + Intergenic
1014474176 6:121852543-121852565 CTTCTGCCATTGCTGTTCCCTGG + Intergenic
1015209952 6:130685706-130685728 CAGCCTGCATTGCTGTTCCTTGG - Intergenic
1015410172 6:132885626-132885648 GAGCTGCCCTTTCTGATGCTAGG - Intergenic
1015840041 6:137467307-137467329 CAGCTTCCATTCCTCTTTCTTGG + Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018285914 6:162237527-162237549 CGGCTGCCTTTGTTGTTGATAGG - Intronic
1019427167 7:983218-983240 CTGCTGCTCTTGCTGTTCCTGGG + Exonic
1020040819 7:4999544-4999566 CCACTGCCAGTGCTGGTGCTTGG - Intronic
1020920566 7:14258621-14258643 CAGCTGCATTTGCTGTCTCTGGG - Intronic
1021270713 7:18581695-18581717 TAACTGCCATTGCTTTTGGTTGG + Intronic
1022596578 7:31718797-31718819 CAGCAGCCCTAGCTGCTGCTAGG + Intergenic
1023152052 7:37211438-37211460 ATGCTGCCACTGCTGTTGTTAGG + Exonic
1023885256 7:44349511-44349533 CAGCTGCTAATCTTGTTGCTAGG - Intergenic
1024026134 7:45411277-45411299 CAGCTGTCTTTGGTGTTCCTTGG + Intergenic
1024179835 7:46881069-46881091 CAGCTGCCACTCCTGGAGCTGGG + Intergenic
1024789832 7:52952788-52952810 CAACTCCCATTTATGTTGCTAGG + Intergenic
1027891724 7:83986178-83986200 CAGCTGCCACTGGTGTTGTTAGG - Intronic
1029332919 7:99874801-99874823 CAGAGTCCATTTCTGTTGCTTGG + Intergenic
1029701401 7:102248845-102248867 CTGCTGCTGCTGCTGTTGCTGGG - Exonic
1030325840 7:108217738-108217760 CATCTGCCATTACTGAGGCTTGG - Intronic
1032537983 7:132680424-132680446 CAGCTGCCTGTGGTGTTGTTGGG - Intronic
1033151154 7:138915967-138915989 CAGCTTCCCTTGCAGTTGCATGG - Intronic
1034164001 7:149012077-149012099 AAGCTGCCATTGAAGGTGCTGGG - Intronic
1035230776 7:157464191-157464213 CCGTTGCCATGACTGTTGCTAGG + Intergenic
1036215877 8:6879337-6879359 CAGCTTTCCTTGCTGGTGCTGGG + Intergenic
1037121885 8:15298461-15298483 CTGCTGCCATCGCTGTTGTGGGG + Intergenic
1038671139 8:29584221-29584243 CAGCTGCCATTTCCCCTGCTTGG + Intergenic
1039077888 8:33709001-33709023 TCGCTGGCACTGCTGTTGCTTGG + Intergenic
1040722351 8:50341062-50341084 CAGCTGCTTTTGTTGTTGTTTGG + Intronic
1041050006 8:53925182-53925204 TATCTGTCATTGCTTTTGCTTGG + Intronic
1041753925 8:61292063-61292085 CTGCTGCCACTGCTGATGCATGG + Intronic
1042337197 8:67640808-67640830 GGGCTGCCACTGCTGCTGCTGGG - Intronic
1042714819 8:71761248-71761270 TAGCTACCATTCCTGGTGCTGGG + Intergenic
1043408526 8:79965867-79965889 CAGCTGACATTGTTCTTGCTTGG - Intronic
1043730133 8:83667645-83667667 CACCTGCCATGCCTGTTGCCAGG - Intergenic
1044117240 8:88350387-88350409 CAGCTGCCATTTCTGCAGTTTGG - Intergenic
1044449306 8:92314885-92314907 AAGCTGCCATTGATGTTCCTGGG - Intergenic
1044790121 8:95838569-95838591 CAGTTTCCTTGGCTGTTGCTGGG - Intergenic
1044937363 8:97306058-97306080 CAGCAGCCTTTGCTGTAGCTAGG + Intergenic
1045828926 8:106434815-106434837 CAGATGCTATTCCTGATGCTGGG + Intronic
1045941940 8:107749461-107749483 TAGCTGCCCTTGCTGATGCTTGG - Intergenic
1046986802 8:120397489-120397511 CAGCTGCCATTTCTGTGGTTAGG + Intronic
1049554223 8:143274194-143274216 CAGCTGCCTCTGCTGTTTCTGGG + Intronic
1050153992 9:2646393-2646415 CTGCAGCCATTGCTGTTGATTGG + Exonic
1051620960 9:19049210-19049232 CAGCTGGGTTTGCTGTTGCTAGG - Intronic
1059023368 9:110599348-110599370 CAGCTGCCATCTCTGTGGTTTGG - Intergenic
1059718342 9:116934310-116934332 CAGCTGGCATTGCTCCTGATGGG - Intronic
1059999504 9:119945335-119945357 GAGCTGTCATTGCTGTTTGTTGG + Intergenic
1062388372 9:136324219-136324241 CAGCTGCCATTACCCATGCTGGG - Intergenic
1186917993 X:14244304-14244326 GAACTGCCACTGCTGGTGCTGGG - Intergenic
1187082652 X:16007337-16007359 CAGCTGCCTTTGCTATGGTTTGG - Intergenic
1187525480 X:20050270-20050292 CTGCTGCCATTGCTGGTCCATGG + Intronic
1187646172 X:21349144-21349166 CAGCTGCCATCTCTGTGGTTCGG + Intergenic
1188976267 X:36679720-36679742 CAGCTACCATTTCTGTTGTTAGG - Intergenic
1189652323 X:43203687-43203709 CAGCTGCCATCTCTGTGGTTTGG - Intergenic
1190081364 X:47359165-47359187 CACCTGACATTGCTGGTCCTAGG - Intergenic
1190931451 X:54952124-54952146 GAGCTGCCCTTGCTCCTGCTTGG - Intronic
1191815668 X:65241689-65241711 CGGCTGCCATTCCTGTGGTTAGG - Intergenic
1192245553 X:69368935-69368957 AAGCTGCCATAGCTGCTGCCTGG - Intergenic
1192368864 X:70497295-70497317 CAGCTGCCATTGCTGCTCAGAGG + Intronic
1196749476 X:119102030-119102052 TAGCTGTCGTTGCTATTGCTGGG + Intronic
1196751933 X:119126124-119126146 ATGCTGCCATTGCTGTTTCATGG + Intronic
1200102644 X:153695580-153695602 AAGCTGCCACTGCTGCTTCTGGG - Exonic
1201707151 Y:16949915-16949937 CATCTGCCTTTGCTGAAGCTTGG + Intergenic