ID: 904824847

View in Genome Browser
Species Human (GRCh38)
Location 1:33267420-33267442
Sequence CTGCATGTATAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904824847 Original CRISPR CTGCATGTATAGATGGAGCA AGG (reversed) Intronic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
910048663 1:82950565-82950587 TTGGACGTATAGATGGAGTAAGG + Intergenic
910679494 1:89847890-89847912 CTGCATGTATATATGAGGTAGGG + Intronic
911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG + Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
913275993 1:117138192-117138214 CAGCATGTAGAGATGGCGGAAGG - Intergenic
913445628 1:118947710-118947732 CTGCAAGTATGGATTAAGCATGG - Intronic
915032659 1:152896844-152896866 CTGCATGTAGGGATGAGGCAAGG - Intergenic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
923384828 1:233455507-233455529 TGCCATGTATAAATGGAGCAGGG + Intergenic
924645133 1:245870497-245870519 ATGCAGGGATAGATGGAGCGAGG - Intronic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1080713648 11:34775307-34775329 CGGGATGTATATATGGAGCAGGG + Intergenic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1113268725 13:108648846-108648868 CTTCATGTATTGCTGGATCAGGG + Intronic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116342532 14:43742930-43742952 TTGCATTTATAAATAGAGCATGG - Intergenic
1117007217 14:51433323-51433345 CTCCATGTATAAATGAACCATGG - Intergenic
1117492652 14:56266865-56266887 TTTAATGTATAGATGCAGCATGG - Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG + Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127874466 15:63099921-63099943 ATACATGTATAGATGGAAAAGGG + Intergenic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131068944 15:89452177-89452199 ATGCATGTATAAATGTATCATGG - Intergenic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1139309549 16:66016958-66016980 CTGAATGAATAGTTGGTGCATGG + Intergenic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1163643091 19:18472957-18472979 CCCCAGGTATAGAAGGAGCAGGG + Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164640529 19:29822033-29822055 CTGCATGTATACATTCAGCCAGG - Exonic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927489966 2:23514796-23514818 CAGCAAGGATAGATGGAGCGTGG - Intronic
927685361 2:25167345-25167367 CTTCATGTTTAAATGGGGCAGGG - Intronic
928338981 2:30425116-30425138 CTGCATGTAATGATAGAACACGG - Intergenic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
939036874 2:137142927-137142949 CTGCATGAATAGATTGAGGGAGG - Intronic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1170201529 20:13749532-13749554 CTGAATGGGTAGATTGAGCAAGG + Intronic
1172414371 20:34752217-34752239 CTGCCTTCATAGTTGGAGCATGG - Intronic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
952478058 3:33731574-33731596 GTGCAGGTGTAGATGGTGCAGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
961833354 3:129636681-129636703 GGGCAGGTATAGATGAAGCAGGG + Intergenic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969324555 4:6433638-6433660 CTGCATGTATAGTTGAACCCAGG - Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974242575 4:59269316-59269338 CTGCTGGTATAGCTGCAGCATGG + Intergenic
976978437 4:91193011-91193033 TTGCATGTATAGTTTGAGGAAGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG + Intergenic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
993818070 5:92577942-92577964 TTGCATGTATAGATGGCTCTGGG - Intergenic
995664307 5:114523965-114523987 CTGACTTTTTAGATGGAGCATGG - Intergenic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
997287594 5:132692660-132692682 TTGTATGTATACATGCAGCATGG - Exonic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1000781056 5:165481777-165481799 CTGCATGAATAGATCATGCATGG - Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002470028 5:179429642-179429664 CAGCCTGTATAGATGAGGCAGGG - Intergenic
1002470060 5:179429814-179429836 CAGCCTGTATAGATGAGGCAGGG - Intergenic
1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG + Intergenic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1005790270 6:29292934-29292956 CTCCATGTATAAATGAACCATGG - Intergenic
1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG + Intronic
1006974468 6:38085728-38085750 CTGCATGTATGGGCTGAGCACGG - Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1010466506 6:76173128-76173150 AGGAATGTATAGGTGGAGCATGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1010903057 6:81451653-81451675 ACGCATGTAAAGATAGAGCAAGG + Intergenic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1016822602 6:148360734-148360756 CTGCAGTTATTTATGGAGCATGG + Intronic
1017053883 6:150420512-150420534 CTGAATGAATGTATGGAGCAGGG - Intergenic
1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1029311068 7:99665358-99665380 CTGCATGTATAGTGGAAGGACGG - Intronic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1034718802 7:153268437-153268459 CTGAATGTAAAGCTGTAGCATGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049416110 8:142496102-142496124 CTGGATGTATAGATGGTAGATGG + Intronic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG + Intronic
1059127622 9:111708113-111708135 TTGCGTGTATATATAGAGCATGG + Intronic
1061768726 9:132900562-132900584 GTGCTTGTATAGCTGGACCACGG + Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1185831428 X:3306549-3306571 CTGCATGTATTTATCTAGCACGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1188359412 X:29234059-29234081 CTGCATTTATTTATGGAGCTTGG - Intronic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1195052045 X:101105983-101106005 CTGCATGTAAAGATCTAGTAGGG - Intronic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic