ID: 904825784

View in Genome Browser
Species Human (GRCh38)
Location 1:33272912-33272934
Sequence CAGAAGGACATTCCTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904825784_904825790 8 Left 904825784 1:33272912-33272934 CCTCTTCCAGGAATGTCCTTCTG 0: 1
1: 0
2: 1
3: 53
4: 399
Right 904825790 1:33272943-33272965 CTCTGTCCTGAACACACTTCTGG 0: 1
1: 0
2: 0
3: 29
4: 188
904825784_904825792 24 Left 904825784 1:33272912-33272934 CCTCTTCCAGGAATGTCCTTCTG 0: 1
1: 0
2: 1
3: 53
4: 399
Right 904825792 1:33272959-33272981 CTTCTGGCCATGTCTCTTTCTGG 0: 1
1: 0
2: 3
3: 22
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904825784 Original CRISPR CAGAAGGACATTCCTGGAAG AGG (reversed) Intronic
900531237 1:3154504-3154526 AGGAAGGCCATTCCTGGAGGCGG - Intronic
900553968 1:3270603-3270625 GAGGAGGACAGTCCTGGATGAGG + Intronic
900554004 1:3270754-3270776 GAGGAGGACAGTCCTGGAGGAGG + Intronic
901682375 1:10920972-10920994 CAGAGGTAAATTCTTGGAAGTGG + Intergenic
902065591 1:13683228-13683250 CAGAAGGGCTTCCCTGGAAATGG + Intergenic
902190525 1:14759911-14759933 CAAAGGGAGAGTCCTGGAAGAGG - Intronic
902648270 1:17819240-17819262 CTGCATGACATTCCGGGAAGCGG - Intronic
902743997 1:18460957-18460979 CAGAAGGGAATTCTAGGAAGTGG - Intergenic
902805133 1:18856262-18856284 CAGAAGAACATTCCAAGAAGAGG - Intronic
903662837 1:24989234-24989256 AGGAAGGACATTCCAGGCAGAGG + Intergenic
904264607 1:29311147-29311169 CAGATGGACAGTCGTGGAAAGGG - Intronic
904321868 1:29703090-29703112 GGGAAGGACATTCGTGGCAGAGG + Intergenic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
904944026 1:34185958-34185980 GAGAAGGGCATTCCTGGTAGTGG - Intronic
905283401 1:36863668-36863690 CAGGAGGGGCTTCCTGGAAGAGG - Intronic
905354815 1:37374103-37374125 GAGAAAGATCTTCCTGGAAGAGG - Intergenic
905471349 1:38194420-38194442 CAGAAAGGCATACCTGGCAGAGG - Intergenic
906592059 1:47034336-47034358 CTGAAGAACATTCCTGTGAGTGG + Intronic
906674022 1:47680130-47680152 CCACAGAACATTCCTGGAAGAGG + Intergenic
907774272 1:57498138-57498160 GAGATGGAGAATCCTGGAAGAGG + Intronic
907942306 1:59100153-59100175 CTGAAGGAAATTGCTAGAAGAGG + Intergenic
910343254 1:86211714-86211736 AAGAAGGGCATTTCAGGAAGAGG - Intergenic
911006090 1:93226069-93226091 TAGAAGGGCATTCCAGGAAAAGG - Intronic
916514599 1:165504094-165504116 CAGAAGGGGCTTCCTGGGAGTGG - Intergenic
917016854 1:170541548-170541570 GAGAAGGACAATTTTGGAAGGGG + Intronic
919273919 1:195386846-195386868 CAAAAGTACATTCCTAGAAATGG - Intergenic
919317564 1:195992753-195992775 AAGAAAGACATTCCTGGCAGAGG - Intergenic
919504603 1:198383554-198383576 CAGAAGAGCATTCCTGATAGAGG + Intergenic
919699155 1:200613308-200613330 GAGAAGGATATTCCAGGGAGAGG - Intronic
921369695 1:214408798-214408820 GAGCAGGACATTCCAGGCAGAGG + Intronic
921854481 1:219967034-219967056 AGGAAGGACATTCCAGGTAGAGG - Intergenic
921857600 1:220003847-220003869 CACAAGGCCATTCCAGGAAAAGG + Intronic
923255519 1:232218394-232218416 GAGGAGCACATTCCTGGCAGTGG - Intergenic
923971138 1:239204565-239204587 GAGAATGACATTCCTGGCATAGG - Intergenic
924863078 1:247946953-247946975 CTTAAGGACATTCCTAGAAAGGG - Intronic
1063183267 10:3626251-3626273 TAGATGGACATTGCTAGAAGAGG - Intergenic
1063243853 10:4198218-4198240 AGAAAGGACATTTCTGGAAGAGG + Intergenic
1063547781 10:6999026-6999048 CAGAAGCTCAGTCCTGGAACTGG + Intergenic
1063828329 10:9923991-9924013 GGGAAGGACATTCCTAGGAGAGG - Intergenic
1064222221 10:13451131-13451153 CAGAAAGACCTTGCTGGCAGTGG - Intronic
1064744472 10:18465003-18465025 CAGATGGATATTCTTGGAGGTGG + Intronic
1064790717 10:18955230-18955252 CAGAAGCACATTCCTGAATTAGG - Intergenic
1065110578 10:22436683-22436705 CAGAAGCACAGCCCAGGAAGTGG + Intronic
1065803269 10:29371920-29371942 CAGAAAAACTTTCATGGAAGGGG - Intergenic
1067041010 10:42953296-42953318 CAGCAGAACCTTGCTGGAAGGGG - Intergenic
1067124903 10:43507717-43507739 CAAAATGACCTTCCTGGATGTGG + Intergenic
1067571596 10:47375840-47375862 CAGAGAGACCCTCCTGGAAGAGG + Intronic
1067709422 10:48636414-48636436 CAAGCAGACATTCCTGGAAGAGG - Intronic
1067760622 10:49042948-49042970 GGGGAGGACATTCCAGGAAGAGG + Intronic
1068224850 10:54094465-54094487 GGGAAGAACATTCCAGGAAGAGG + Intronic
1069821481 10:71231214-71231236 CAGCAGGAAATGCTTGGAAGAGG - Intronic
1069863716 10:71487083-71487105 GAGAAGGCCATTCCAGGCAGGGG - Intronic
1072125214 10:92439689-92439711 CAGAAGAATATGCCTGGAAGTGG + Intergenic
1072538800 10:96382979-96383001 AAGAAGGATATTCCAGGGAGAGG + Intronic
1072881952 10:99236548-99236570 CTGAAGGACATTCCCCGAAGAGG + Intergenic
1074895287 10:117772169-117772191 CTAAAGCACATTCCTGAAAGCGG - Intergenic
1077408495 11:2393002-2393024 CTGCAGGGCATTCCTGGCAGAGG + Intronic
1077512556 11:2976639-2976661 CAGAAGGACATTCAAGGCAGAGG - Intronic
1078237721 11:9501691-9501713 GAGAAGGGTATTCCTGGCAGGGG + Intronic
1080278565 11:30530560-30530582 GAGACGGTCATTCCAGGAAGTGG + Intronic
1080440614 11:32290924-32290946 GGGAAGGACATTCCAGGCAGAGG - Intergenic
1081649588 11:44815004-44815026 CAGAAGAGCATTCCAGGCAGAGG + Intronic
1084283737 11:68118020-68118042 CAGAAGCACATTCCTGGGTGGGG + Intronic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1087615661 11:100483759-100483781 CAGAAGCAGATTCCGAGAAGAGG - Intergenic
1089413821 11:118270019-118270041 AGGAAGGACATTCCGGGCAGAGG + Intergenic
1090421794 11:126580411-126580433 CAGGAGGACATTCTAGGAGGAGG + Intronic
1090442887 11:126738687-126738709 CAAAAGGACATTTCTGGGAAGGG - Intronic
1090659964 11:128874932-128874954 CAGAGGGACTCTGCTGGAAGAGG + Intergenic
1090737806 11:129626176-129626198 CTGAAGGAGATCCCTGGAGGGGG + Intergenic
1091094562 11:132808346-132808368 CTGAAAGAAATTCCTGGCAGTGG + Intronic
1091129853 11:133136576-133136598 AGGAAGGGCATTCCAGGAAGAGG + Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1091431586 12:439970-439992 AGGAAGAACATTCCTGGCAGAGG + Intronic
1091674674 12:2480341-2480363 CAGAAAGGCTTTCCAGGAAGTGG - Intronic
1092440901 12:8501935-8501957 GAGAAGAACCTTCCTGGGAGAGG - Intergenic
1096768176 12:53911767-53911789 GAGAAGAACATTCCAGGCAGGGG + Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1096879138 12:54653430-54653452 CAGGAGGAGATTCCAGGAGGAGG + Intergenic
1096885766 12:54717630-54717652 CAGAATGAGTTTGCTGGAAGTGG + Intergenic
1098550269 12:71754785-71754807 CAGAAGAACGTGCCTGGACGTGG - Intergenic
1099063227 12:77939301-77939323 GAGAAGGACCTTCCTTGCAGTGG - Intronic
1099752698 12:86798321-86798343 GGGAAGAACATTCCTGGCAGAGG - Intronic
1100232046 12:92618552-92618574 GACAAGGACATTTCAGGAAGAGG + Intergenic
1101847413 12:108373654-108373676 AGGAAGGACATTCCTGGTAGAGG + Intergenic
1102182186 12:110920949-110920971 CAGAAAGACATTCCAGGTAGAGG - Intergenic
1103472372 12:121192174-121192196 AAGAAGGGCATTCCAGGAAGAGG + Intergenic
1103570770 12:121843362-121843384 AAGAAAGGCATTCCTGGCAGAGG - Intronic
1104134951 12:125928591-125928613 CAGAACAGCATCCCTGGAAGAGG + Intergenic
1104609407 12:130216232-130216254 CAAAAGAACATTCCAGAAAGAGG + Intergenic
1105209170 13:18247760-18247782 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1106027463 13:25968590-25968612 CAAAAAGACATTGCTGGAGGAGG + Exonic
1107448253 13:40486851-40486873 CAGCTGGACATTCCAGGCAGAGG + Intergenic
1107720123 13:43239400-43239422 CAGAAGAACTATGCTGGAAGTGG + Intronic
1108129244 13:47279518-47279540 CAGGATGCCATTCCTTGAAGTGG - Intergenic
1109067506 13:57717193-57717215 CAGAAGGGAATTCAGGGAAGGGG + Intronic
1110869450 13:80433221-80433243 CAGAAGGAAATTCCTCTAAAAGG + Intergenic
1111675300 13:91379480-91379502 CAGAAAGACATTCCAAGAAATGG - Intergenic
1112126123 13:96470486-96470508 CAGAATGACATATCTTGAAGAGG - Intronic
1113400974 13:109992977-109992999 TTGAAGGGCATTCCTGGAAGAGG - Intergenic
1113435288 13:110286496-110286518 AAGAAATCCATTCCTGGAAGAGG + Intronic
1113504492 13:110805812-110805834 CAGAAGGAGATTCTCTGAAGTGG - Intergenic
1114613212 14:24055368-24055390 CAGAAGGGCACTCCTGGGAAGGG - Intronic
1115394795 14:32896347-32896369 CAGAAGGACTACCCTGGAATTGG + Intergenic
1115491648 14:33964049-33964071 TAGAAGAGCATTCCAGGAAGAGG + Intronic
1116707914 14:48326864-48326886 CTGAAGAACATTCCAGGCAGAGG + Intergenic
1117582352 14:57164695-57164717 CTGCAGGCCATTCCTGGAATGGG + Intergenic
1119934191 14:78575507-78575529 CAGAAGCCCATTCATGAAAGTGG + Intronic
1121647146 14:95526186-95526208 AGGAGGGACATTCCAGGAAGAGG - Intergenic
1122036605 14:98953695-98953717 CTGCAGGACACTCCTGGGAGAGG + Intergenic
1122484752 14:102071525-102071547 GAGAAGAACATTCCAGGAAGTGG - Intergenic
1126333092 15:47555217-47555239 CATTAGGACATTCTTGAAAGGGG - Intronic
1126511779 15:49484424-49484446 CAAAAGGGGATTCCTGTAAGAGG + Exonic
1128067198 15:64772804-64772826 CGGAAGGACTTGCCAGGAAGTGG - Intronic
1128345371 15:66849635-66849657 CACAAGGACCTTCCAGGGAGAGG - Intergenic
1128387292 15:67158936-67158958 CAGAAAGATATTCCAGAAAGTGG - Intronic
1128525017 15:68406443-68406465 AAGAAGAGCATTCCAGGAAGAGG - Intronic
1128991491 15:72264437-72264459 CAGAAAGACATTTTTGGAAGGGG + Intronic
1129121451 15:73399331-73399353 GGGGAGGACATTCTTGGAAGAGG - Intergenic
1129598605 15:76983873-76983895 CAGCAGGTCCTTCCTTGAAGGGG + Intergenic
1129685480 15:77684051-77684073 GGAAAGGACATTCCAGGAAGAGG - Intronic
1130796955 15:87219753-87219775 CAGAAGAATATTTCTGAAAGAGG + Intergenic
1130919962 15:88335580-88335602 GGGAAGGGCATTCCTGGGAGAGG + Intergenic
1131108446 15:89750048-89750070 CAGACTGCCTTTCCTGGAAGAGG - Exonic
1131229678 15:90650844-90650866 CTTAAAGGCATTCCTGGAAGTGG - Intergenic
1132253574 15:100353774-100353796 CAGATGGTCATTTGTGGAAGAGG + Intergenic
1132396699 15:101479895-101479917 CAGGGGGACAGTCCAGGAAGGGG + Intronic
1132752320 16:1464481-1464503 CAGAAGGGCAGCCCCGGAAGAGG + Intronic
1132770615 16:1560650-1560672 CAGAGGGACATTCCGAGAAGGGG - Intronic
1133116204 16:3579221-3579243 CTGATGGACATTCCTGCGAGGGG - Intergenic
1133643622 16:7741881-7741903 AAGATGGACATTTCTGGAACAGG + Intergenic
1134016568 16:10892485-10892507 CAGAGGGAGCTTCCTGGAGGAGG - Intronic
1134914306 16:18056989-18057011 GGGAAGGGCATTCCTGGAAAAGG - Intergenic
1135350381 16:21724336-21724358 AAGATGGACATTCCAGGCAGTGG + Intronic
1135499296 16:22979907-22979929 GAGAAGAACATTCCAGGTAGAGG + Intergenic
1137683563 16:50370834-50370856 CAGAAAAATGTTCCTGGAAGTGG + Intergenic
1137900895 16:52267718-52267740 GAGAAGGACTCGCCTGGAAGTGG - Intergenic
1138120318 16:54396164-54396186 GAGATGCACATTCCAGGAAGAGG - Intergenic
1138529873 16:57629247-57629269 CACAAGGAGATGCCTGGGAGGGG + Intronic
1139258760 16:65571225-65571247 CTTAAGTACATTCCTAGAAGTGG - Intergenic
1139435417 16:66934114-66934136 CAGCAGGGCGTTCCTGGCAGAGG - Intronic
1139761693 16:69188966-69188988 CAGGAGGGTATTCCTGGCAGAGG + Intronic
1142409042 16:89907166-89907188 CAGAAGGACTCTGCTGGGAGAGG + Intronic
1142858042 17:2743668-2743690 GTGAAGGGCATTCCTGGCAGAGG - Intergenic
1143327155 17:6106857-6106879 GTGAAGGGCATTCCTGGCAGGGG + Intronic
1144133579 17:12271194-12271216 GAGAAGAACATTCTTGGCAGAGG - Intergenic
1144762828 17:17717045-17717067 CAGAAGTCCATTTGTGGAAGAGG + Intronic
1145057315 17:19711764-19711786 CAGAAATGCATTACTGGAAGTGG - Intronic
1146477646 17:33176063-33176085 ATGAAGGACATTCCAGTAAGGGG - Intronic
1146486546 17:33247664-33247686 CAGAAGGAGCTTCCTGGAGCAGG + Intronic
1146566556 17:33918131-33918153 GAGAAGGATTTTCCTGGAAAAGG - Intronic
1147049087 17:37777599-37777621 AAGAAGGACATTCTCTGAAGGGG - Intergenic
1147183274 17:38700254-38700276 CAGAAGAGCATTCCAGGCAGGGG - Intergenic
1147454073 17:40524220-40524242 TACAAAGACATTTCTGGAAGAGG - Intergenic
1148093214 17:45034991-45035013 CAGAAGGACCTGCTTGGGAGAGG + Exonic
1148260849 17:46181858-46181880 AAGAAGGACCTTCCAGGTAGAGG - Intronic
1148999315 17:51740777-51740799 GGGAAGGACATTCCAGGCAGAGG - Intronic
1150130852 17:62667987-62668009 GGGAAGGGCATTCCTGGCAGAGG + Intronic
1151787205 17:76280823-76280845 CAGAAGGACATTGCTGTGAGCGG - Exonic
1152010342 17:77709256-77709278 CAGAAGAGCTTTCCTGGAAGAGG + Intergenic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1153925040 18:9828073-9828095 GAGGAGGAAATTCCAGGAAGGGG + Intronic
1156423026 18:36976806-36976828 CAGAAGGAAATCTCTGAAAGTGG + Intronic
1156546909 18:37972728-37972750 CAGAAGAGGATTCCTGGAAAAGG - Intergenic
1157162529 18:45327076-45327098 CATTAGGAAATTCCTGGCAGTGG + Intronic
1158549388 18:58422263-58422285 AAGAAGGACATTCCCTGTAGAGG - Intergenic
1160207355 18:76845876-76845898 CAGAAGGCCATCCCATGAAGAGG + Intronic
1160331447 18:77995796-77995818 GAGAAGGACAGTTCTGGAAAGGG + Intergenic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1163205833 19:15802103-15802125 GAGAAGGGAATTCCTGGTAGTGG + Intergenic
1163258162 19:16170299-16170321 GAGAAGGGGGTTCCTGGAAGAGG + Intronic
1163505442 19:17703265-17703287 AGGAAGGACATTCCTGGCCGAGG + Intergenic
1163702516 19:18793268-18793290 CAGAAAGTCATTCCAGGTAGAGG + Intergenic
1163777961 19:19228807-19228829 AGAAAGGACATTCCTGGCAGAGG + Intronic
1164566122 19:29327319-29327341 ATGACGGACATTCCTGGGAGGGG - Intergenic
1165233482 19:34402362-34402384 CAAAAGTACATTCCAGAAAGCGG - Intronic
1165443727 19:35845468-35845490 CAGAAGGACGCTCCTGGCGGCGG + Exonic
1166129119 19:40735319-40735341 TAGAAGAGCATTCCTGGCAGAGG - Intronic
1166318870 19:42004046-42004068 GAGAGGGACATTCCAGGCAGAGG - Intronic
1166427420 19:42691991-42692013 CTGGAGGACATGCCTGGCAGGGG + Intronic
1166556227 19:43701604-43701626 GAGGAGGACATTCCAGGCAGAGG + Intergenic
1166672543 19:44719537-44719559 GGGAAGGAAATTCCTGGCAGCGG - Intergenic
1167090961 19:47343440-47343462 CAGAAGGACATTCCAGCCAGTGG - Intergenic
1167294558 19:48642026-48642048 GAGAAGGGCATTCCAAGAAGAGG + Intronic
925973226 2:9122312-9122334 CAGAAGGAAACTCTTGGAGGAGG - Intergenic
926734285 2:16060882-16060904 GAGAAGGACATTCCCAGAGGAGG + Intergenic
927274049 2:21246463-21246485 ATGAAGGGCATTCCAGGAAGAGG - Intergenic
927623072 2:24682612-24682634 AGGAAGAACATTCCAGGAAGTGG - Intronic
928210086 2:29317449-29317471 CAGAAGGACACTGGGGGAAGAGG - Intronic
928680394 2:33695463-33695485 AAGGAGGACATTTCTGAAAGCGG - Intergenic
929399675 2:41565575-41565597 AAGAAGAACATTCCAGGCAGAGG + Intergenic
930466128 2:51752003-51752025 CAGAAAAACATTCTTGAAAGAGG - Intergenic
932952496 2:76310522-76310544 CAGAAAGTCATACCTGGAAGGGG + Intergenic
933161010 2:79025483-79025505 CAGAAGAAGATATCTGGAAGAGG + Intergenic
933280717 2:80329999-80330021 TAGAAGGACATGGCAGGAAGGGG - Intronic
933904442 2:86876305-86876327 CAGAAGGGCATTCTAGGCAGAGG + Intergenic
934539900 2:95165385-95165407 CAGAATCAAATTCCTGAAAGTGG + Intronic
934959572 2:98659079-98659101 CAGAAGAGGATGCCTGGAAGAGG + Intronic
936367798 2:111875846-111875868 CAGAAGGGCATTCTAGGCAGAGG - Intronic
936449263 2:112621202-112621224 GCCAAGGACATTCTTGGAAGAGG + Intergenic
936904501 2:117521503-117521525 GAGAAGGACATTCCAGGCACAGG - Intergenic
937017607 2:118619997-118620019 CAGAAGGGCATTCTTGGCAAAGG - Intergenic
937121278 2:119441476-119441498 CAGAAGGAGCTACCTGGGAGGGG - Intronic
938376321 2:130809165-130809187 GGGAAGAACATTCCAGGAAGAGG - Intergenic
938627837 2:133130747-133130769 CAGAAACTCATTCCTGGAACTGG + Intronic
938690347 2:133782664-133782686 CAGAAGGGCACTCCAGGCAGAGG + Intergenic
938749458 2:134314750-134314772 GAGAAGGACGTTCCAGGGAGAGG + Intronic
939424698 2:142019822-142019844 GAGAAGCACATTCCAGGGAGAGG - Intronic
940398209 2:153218201-153218223 CAGTAGAATATTTCTGGAAGAGG - Intergenic
940766089 2:157791008-157791030 AAGAAGGACATTGCAGGCAGGGG - Intronic
942953805 2:181751065-181751087 CAGAAAGGCATTCCAGGCAGAGG - Intergenic
944434386 2:199671398-199671420 GAGAAGGGCATTCCAGGCAGAGG + Intergenic
945411798 2:209518439-209518461 AAGAAGGACATTTCTTGAAAGGG + Intronic
945539687 2:211069412-211069434 GAGAAGGACATTACTGTCAGTGG - Intergenic
945726751 2:213479168-213479190 AAGAAGAACATTCCTGGCATAGG - Intronic
948570169 2:238912795-238912817 CACACACACATTCCTGGAAGAGG + Intergenic
948630779 2:239301185-239301207 CAGAAGGCCCCTTCTGGAAGGGG + Intronic
1168942057 20:1721132-1721154 AAGAAGGACCTGCCTGGAATCGG + Intergenic
1170259953 20:14393488-14393510 CAGAAAGAGATTCCAGGCAGAGG - Intronic
1170441904 20:16387644-16387666 TAGAAGGAAATGTCTGGAAGGGG + Intronic
1171154321 20:22858611-22858633 CAGAATGACATTCCAGGCAGAGG + Intergenic
1171290344 20:23979473-23979495 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1172873009 20:38147452-38147474 GAGAAGGGCATTCCAGGCAGAGG - Intronic
1173258101 20:41409334-41409356 CCGCAGGCCTTTCCTGGAAGGGG - Intronic
1173929090 20:46803695-46803717 CAGAAGGACACTCTAGGCAGAGG - Intergenic
1174122780 20:48279309-48279331 GAGCAGGACATTCCTGAAAGAGG - Intergenic
1174394688 20:50239693-50239715 AAGAAGGACATTCCAGGCAGAGG + Intergenic
1174406580 20:50306850-50306872 AGGAAGGGCATTCCTGGCAGAGG - Intergenic
1174472774 20:50772729-50772751 CTGAAGTAAATTCCTAGAAGAGG + Intergenic
1175359113 20:58393556-58393578 CAGATGGACTCTCATGGAAGGGG - Intronic
1175491093 20:59381656-59381678 CAGAAAGACATTCTTGGGACAGG + Intergenic
1175681085 20:60989405-60989427 CAGAAGGACGTTCAGGGCAGAGG + Intergenic
1177113590 21:17058591-17058613 TAGAAGGACATTTCAGGCAGAGG + Intergenic
1179024837 21:37671349-37671371 CACATGGATGTTCCTGGAAGGGG + Intronic
1179481603 21:41682077-41682099 CAGAAGGGCTTTCCCGGATGAGG - Intergenic
1180767085 22:18351537-18351559 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1180779226 22:18510842-18510864 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1180811945 22:18768162-18768184 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1181198100 22:21202406-21202428 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1181401644 22:22653398-22653420 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1181703602 22:24634495-24634517 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1181931158 22:26402798-26402820 CAGAGAGATATGCCTGGAAGCGG + Intergenic
1182194664 22:28504206-28504228 TAGAAGGATATACCTGAAAGAGG - Intronic
1182450117 22:30415021-30415043 TAGAAGGACATTCCATGCAGAGG - Intronic
1182471104 22:30548792-30548814 AAGAAAGGCATTCCAGGAAGAGG - Intergenic
1182867686 22:33618667-33618689 CAAAAATACATACCTGGAAGGGG + Intronic
1184196422 22:42932235-42932257 GGGAAGAACATTCCTGGCAGAGG - Intronic
1184359424 22:44005865-44005887 CAGAAGTACACTCCTCAAAGTGG - Intronic
1184410909 22:44325844-44325866 CAGAGGGGCATTTCGGGAAGAGG - Intergenic
1184545123 22:45162653-45162675 GAGCAGGGCATTCCTGAAAGCGG - Intergenic
1184882848 22:47322264-47322286 CAGATGGGCATTCCAGGAAGAGG - Intergenic
1185019964 22:48368544-48368566 CAGGAAAACATTCCTGGAACAGG + Intergenic
1185025249 22:48405186-48405208 GAGAGGGACATTGCTGGAACTGG - Intergenic
1185074403 22:48675571-48675593 CAGCAGGACAGTCCTGGTGGCGG + Intronic
1185333198 22:50260788-50260810 CGGGAGGATTTTCCTGGAAGGGG - Intronic
1203228707 22_KI270731v1_random:92431-92453 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
949939563 3:9144401-9144423 GAGAAGGGCATTCCAGGCAGAGG - Intronic
950155644 3:10719692-10719714 AGGAAGGGCATGCCTGGAAGTGG + Intergenic
950190549 3:10973538-10973560 TAGAAGGACAGTCCTGAAACTGG - Intergenic
950369659 3:12518424-12518446 GGGAAGGACATTCCAGGCAGAGG - Intronic
950591511 3:13939022-13939044 GAGTAGGGCATTCCTGAAAGCGG + Intronic
950663144 3:14479402-14479424 AAGAAGGGCATTTCTGGCAGAGG + Intronic
951257927 3:20472181-20472203 CAGATAGACATTCCTGGTGGGGG - Intergenic
952212422 3:31241648-31241670 CAGCAGGTCCTTCCTTGAAGGGG - Intergenic
952236522 3:31486173-31486195 GAGAAGAACATTTCAGGAAGAGG - Intergenic
952627132 3:35419255-35419277 CAATAGGAGATTCCTGGAAAAGG - Intergenic
953366702 3:42351549-42351571 CAGAAGGACAGTCCTGGGCCTGG + Intergenic
954576945 3:51681562-51681584 AAGAAGGACATTTCAGGCAGAGG + Intronic
955905617 3:63804505-63804527 GAGAAGAACATTCCAGGCAGAGG - Intergenic
955958961 3:64319473-64319495 GAGAAGGGCATTCCAGGGAGAGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
956083971 3:65590050-65590072 AATGAAGACATTCCTGGAAGAGG - Intronic
956224235 3:66937901-66937923 AGAAAGGACATTCCTGGCAGAGG - Intergenic
956746439 3:72314646-72314668 TGGAAGGTGATTCCTGGAAGGGG - Intergenic
957233577 3:77553908-77553930 CAGAAGTTCATTCATGAAAGTGG + Intronic
957873690 3:86117445-86117467 CTGAAGGACCTTCGTGGAAGAGG + Intergenic
958704161 3:97632648-97632670 TAGAATGACCTTCCTGGAAGAGG + Intronic
959362916 3:105417166-105417188 CATAAGAGCCTTCCTGGAAGAGG - Intronic
960846785 3:122011386-122011408 AATAAGGGCATTCATGGAAGGGG - Intronic
962122459 3:132576371-132576393 CACAAAAACATTCCTGGAAGAGG + Intronic
962249981 3:133830116-133830138 CAGCAGGGCATTCCTGGCAGTGG - Intronic
962875961 3:139536254-139536276 CGGAAGGACATGGCTGGATGGGG - Intronic
963148082 3:142015407-142015429 AAGAAGGAGATTTCTGGATGGGG - Intronic
965480490 3:169212852-169212874 CAGGAGAGCATTCCAGGAAGAGG - Intronic
966178933 3:177170363-177170385 AAGAAGGACATTCCAAAAAGAGG - Intronic
967094740 3:186168071-186168093 AAGAAGGACATTCCAGGCACAGG + Intronic
967113625 3:186317622-186317644 GAGAAGGGCATTCCGGGTAGAGG - Intronic
967381981 3:188869089-188869111 AACAAGGAGATTCCTGGCAGAGG + Intronic
967679980 3:192350599-192350621 TGGAAGGACATTCCAGAAAGAGG + Intronic
967978148 3:195046748-195046770 CTGCAGGTCATTCCTGGAAAAGG + Intergenic
968532568 4:1101241-1101263 CAGAAGGATATAACTTGAAGAGG - Intronic
968812109 4:2804750-2804772 CAGCAGGAAATGCCTGGTAGGGG + Intronic
969381544 4:6802274-6802296 CAGGATGACTTGCCTGGAAGAGG + Intronic
970695639 4:18673654-18673676 AAGAAAAACATTACTGGAAGAGG + Intergenic
970733503 4:19137464-19137486 TAAAAGGACAGTTCTGGAAGTGG - Intergenic
971873609 4:32275768-32275790 AAGAAGAACATTCCAGAAAGGGG - Intergenic
972802201 4:42488720-42488742 GAGGAGGACATTCCAGGAAGAGG - Intronic
973051931 4:45608507-45608529 GAGAAGGAGAAACCTGGAAGTGG - Intergenic
973085682 4:46056376-46056398 CAGAAAGATATTCCAGGCAGGGG - Intronic
973133543 4:46677616-46677638 CAGAATGTTATTCCTGGCAGAGG - Intergenic
973537050 4:51893985-51894007 GAGAAGCAATTTCCTGGAAGAGG + Intronic
973584071 4:52373732-52373754 CAGAAGGGAATTCCAGGCAGAGG + Intergenic
973735976 4:53872122-53872144 CATAATGACATTCCTGAGAGTGG - Intronic
973741670 4:53924805-53924827 GAGAAGGACATTTCTAGCAGAGG - Intronic
975475767 4:74821659-74821681 GAGAAGGATATTCCAGGCAGAGG + Intergenic
975969236 4:80014034-80014056 CAGCAGTACATGCCTGGGAGAGG - Intronic
976338498 4:83918813-83918835 GGGAAGGTCATTCCTGGCAGAGG + Intergenic
976586077 4:86798647-86798669 CAGAAGGACACTCCTGTACCTGG - Intronic
976830009 4:89305225-89305247 GGGAAGGACATTCCTGGCACGGG - Intronic
976842718 4:89450799-89450821 AAGAAGCACATTCCAGGCAGAGG - Intergenic
977586340 4:98779385-98779407 TAGAAGGACATTCTAGGAAAAGG + Intergenic
977718357 4:100209426-100209448 CACATGGAGGTTCCTGGAAGGGG + Intergenic
978310078 4:107378234-107378256 TAGAAGGACATTCCTAAAAGAGG - Intergenic
978317634 4:107457339-107457361 TAGAAGGACATTACAGGAAAAGG - Intergenic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980889528 4:138799588-138799610 TAATAGGACATTCCTGGAAGAGG + Intergenic
982381023 4:154747488-154747510 CAGTAGGAAATTTCTAGAAGGGG - Intronic
983065562 4:163206253-163206275 GAGAAGAACATTCCAGAAAGAGG + Intergenic
983845072 4:172507551-172507573 GAGAAGAGCATTTCTGGAAGAGG - Intronic
984819085 4:183864283-183864305 CAGAATAACATTCCTGAAAGGGG - Intronic
985727993 5:1525620-1525642 CAGAAGCACAGGCCAGGAAGCGG + Intergenic
986007194 5:3677917-3677939 CAGCAGGGCCCTCCTGGAAGAGG + Intergenic
988087851 5:26494981-26495003 AAGAAGGACAAAGCTGGAAGTGG + Intergenic
988952188 5:36274463-36274485 AAGAAGGACATTCCAAGCAGAGG + Intronic
989164548 5:38421816-38421838 AAGAAGGACATTCCAGGCAGAGG + Intronic
989638983 5:43565133-43565155 CAGAAAGACGTTACTGGAAAGGG - Intergenic
991646564 5:68807121-68807143 CAGAAGGACATACCAGAGAGAGG - Intergenic
991690675 5:69222310-69222332 CAGAAGGATAGGCATGGAAGTGG + Intronic
992376274 5:76190844-76190866 GATAAGGACATTTCTGGAAATGG - Intronic
992417646 5:76566971-76566993 CAGAAGGGCCTTCCTTGGAGAGG + Intronic
992596396 5:78351818-78351840 CAGAAGGGCATTCTTGGTAGAGG + Intergenic
994193391 5:96894297-96894319 CTGAAGGGCATTCATGGAAAGGG - Intronic
994501475 5:100584059-100584081 CAGAAGTACATTGCTAGTAGGGG - Intronic
995588078 5:113670218-113670240 CAGGAAGACATTCCTGGCAGAGG - Intergenic
996284800 5:121776860-121776882 GAGAAGAACATTCCAGGCAGAGG - Intergenic
996395059 5:123005315-123005337 GAGAAGGGCATTCCTGGCAGAGG - Intronic
996696499 5:126402461-126402483 CAGAATTACATTCTTTGAAGAGG - Intronic
998341344 5:141420696-141420718 AGGAACGACATTTCTGGAAGTGG - Intronic
998389024 5:141774987-141775009 CAGAAGAGCATTCCAGGCAGAGG - Intergenic
998555380 5:143118161-143118183 CAGAAGAACATTTCAGGCAGAGG + Intronic
999568872 5:152896058-152896080 AAGAAGCACATTCCAGAAAGAGG + Intergenic
999812966 5:155145487-155145509 CAGAGTGAAAATCCTGGAAGGGG + Intergenic
1001571038 5:172730799-172730821 CAGAAGAACATCCATGTAAGAGG - Intergenic
1001697008 5:173678299-173678321 CAGAAGAACATTCCAGGCAGAGG + Intergenic
1003024217 6:2539026-2539048 CAGAAGCACATTCCAGGCAGAGG - Intergenic
1003138255 6:3450068-3450090 AAGTAGAACATTTCTGGAAGGGG + Intronic
1003978925 6:11371002-11371024 CAGAAGGTCCTTCCAGGCAGAGG + Intronic
1004435476 6:15588806-15588828 AACAAAGACATTCCAGGAAGAGG - Intronic
1004886125 6:20053261-20053283 CAGAAGGAGATTGTGGGAAGAGG + Intergenic
1005634767 6:27742923-27742945 CTGAGGGATATTCCTAGAAGTGG - Intergenic
1006445065 6:34075408-34075430 GAGAAGGGCATTTCTGGCAGAGG - Intronic
1006791462 6:36703985-36704007 GAGAAGGGCATTCCAGGTAGAGG + Intronic
1007238770 6:40410301-40410323 CACAAGAACATCACTGGAAGAGG + Intronic
1008969219 6:57347128-57347150 CAGAAGGATTCTCCTGGAATGGG - Intronic
1010811092 6:80299442-80299464 CAGAAAGATGTTACTGGAAGGGG + Intronic
1012643478 6:101651641-101651663 CAGAAGAACATTCCAGGCAAAGG + Intronic
1014470178 6:121803415-121803437 AAGGAGGGCATTCCTGGCAGAGG - Intergenic
1014477532 6:121891857-121891879 AACAAAGACATTCCTAGAAGAGG + Intergenic
1015036626 6:128663648-128663670 TAGGAGTACATTCCTGGAAGAGG - Intergenic
1015209599 6:130682265-130682287 CAGAAGTACACTTCTGGAATGGG + Intergenic
1015491057 6:133825980-133826002 GAGAAGTACGTTCCAGGAAGGGG - Intergenic
1015746624 6:136516531-136516553 CAGAAGTACATACCAGGTAGAGG + Intronic
1017373481 6:153739414-153739436 AGGAAGAACATTCCAGGAAGAGG + Intergenic
1018361557 6:163075973-163075995 CAGAAGGTCCACCCTGGAAGGGG + Intronic
1019305769 7:333681-333703 GACAAGGACATTCCTGGACCCGG - Intergenic
1021178632 7:17480017-17480039 TGGAAGGATATTTCTGGAAGAGG - Intergenic
1021737967 7:23657624-23657646 CTGAAGGACCATCCTGGAAAGGG - Intergenic
1021866912 7:24967365-24967387 GAGAAGGACATTTCAGGTAGAGG - Intronic
1022414706 7:30167973-30167995 CAGAAGGACGTTCCTGTAGGAGG + Intergenic
1022804407 7:33807424-33807446 CAGAAGCCCATTCCAGGAACAGG - Intergenic
1023306448 7:38833531-38833553 CAGAAAGGCATTCCAGGCAGAGG - Intronic
1023995038 7:45154639-45154661 ATGAAGGAGATTCCAGGAAGGGG - Intergenic
1027368882 7:77486974-77486996 CAGAAGGATGTTGCTGGCAGTGG - Intergenic
1027642685 7:80756722-80756744 CAGAATAACATTCCAGGAAGAGG - Intronic
1028637144 7:93002034-93002056 AAGAAGGACATTACTAGCAGAGG - Intergenic
1028835467 7:95369943-95369965 CAGACGGACATTCCAGGCAGAGG + Intronic
1030128592 7:106178262-106178284 CAGAGGGGCATTCCTGGCTGTGG - Intergenic
1031989763 7:128189867-128189889 CAGAAGAACATGCCAAGAAGGGG - Intergenic
1033014054 7:137653640-137653662 GAGAAGGGGCTTCCTGGAAGAGG - Intronic
1033426451 7:141249063-141249085 AAGAAGGGCCTACCTGGAAGAGG + Intronic
1033536016 7:142312825-142312847 CAGAAGGAGATTTCTTGAATGGG + Intergenic
1033658845 7:143390379-143390401 CACTAGGACCTTCCTGCAAGAGG - Intronic
1036933545 8:12979106-12979128 CAGAGGGAGTTTCCTGTAAGAGG - Intronic
1040929443 8:52718238-52718260 GGGAAGAACATTCCTGGATGAGG - Intronic
1041013335 8:53566486-53566508 GAGATGGACATTCCAAGAAGAGG + Intergenic
1041497322 8:58501271-58501293 AGGAAGGATATTCCAGGAAGAGG + Intergenic
1042124577 8:65525185-65525207 GAGAAGGACATCCCAGGCAGAGG - Intergenic
1042292008 8:67178694-67178716 AGGAAGAACATTCCAGGAAGAGG + Intronic
1043108929 8:76152651-76152673 CAGAAGCACAGTTATGGAAGTGG - Intergenic
1043476624 8:80611594-80611616 CAGCAGGGCAAGCCTGGAAGGGG + Intergenic
1044707333 8:95021295-95021317 CACAAGGACAATCCAGAAAGAGG + Intronic
1045428100 8:102087217-102087239 CAGAAGGATGTTACTGGAAAGGG - Intronic
1045557273 8:103226466-103226488 CAGCAGGTCATTTCTGGAATGGG + Intronic
1045912940 8:107431543-107431565 GATGAAGACATTCCTGGAAGAGG - Intronic
1045985995 8:108250342-108250364 GAGAAGAACATTCCGGGTAGAGG - Intronic
1046718105 8:117589222-117589244 AAGAAGGACATGCCTGGGAAAGG + Intergenic
1047761794 8:127959994-127960016 CAGTATGTGATTCCTGGAAGGGG + Intergenic
1048375327 8:133818072-133818094 CAGGAGGCCTTTCCAGGAAGAGG - Intergenic
1048732770 8:137462176-137462198 CAGCAGTACATACCTGGCAGTGG - Intergenic
1048852470 8:138658089-138658111 CAGAAGGAGGATCCTGGAACAGG + Intronic
1049295657 8:141834589-141834611 CAAACGTACATTCCTGGAGGAGG + Intergenic
1049456554 8:142694346-142694368 CAGAAAGATGTTGCTGGAAGAGG + Intergenic
1049466580 8:142753704-142753726 GGGAAGGGCATTCCTGGCAGTGG - Intergenic
1049546844 8:143236209-143236231 CAGAGGGACTGTCCTGGCAGAGG - Intergenic
1049550801 8:143258322-143258344 CAGGAGGCCAGGCCTGGAAGAGG - Intronic
1049706479 8:144045525-144045547 CAGCAGGACATAGCTGGAAGAGG + Intronic
1049968937 9:804335-804357 GAGAAGGGCATTCCAGGCAGAGG - Intergenic
1050009262 9:1169591-1169613 GAGAAGGATATTCCAGGAGGAGG + Intergenic
1050926715 9:11273119-11273141 CAGAAGGTCTTTTCTGGAAAGGG - Intergenic
1051331384 9:16028063-16028085 GTGAAGGACATTCCAGGGAGGGG + Intronic
1052384401 9:27807156-27807178 GAGGAGGACATTTCTGGATGTGG + Intergenic
1052397849 9:27962548-27962570 CTGAAGGACAGTCGTAGAAGGGG - Intronic
1053621033 9:39817593-39817615 CAAAAGGGGATTCCTGTAAGAGG - Intergenic
1053884067 9:42626735-42626757 CAAAAGGGGATTCCTGTAAGAGG + Intergenic
1053888601 9:42667559-42667581 CAAAAGGGGATTCCTGTAAGAGG - Intergenic
1054223087 9:62434181-62434203 CAAAAGGGGATTCCTGTAAGAGG + Intergenic
1054227623 9:62475006-62475028 CAAAAGGGGATTCCTGTAAGAGG - Intergenic
1054263129 9:62889848-62889870 CAAAAGGGGATTCCTGTAAGAGG + Intergenic
1056602966 9:88060969-88060991 CAGAAGGATATACATGGATGTGG + Intergenic
1058735702 9:107892003-107892025 GAGAAGGGCATTCTAGGAAGAGG - Intergenic
1058744352 9:107975268-107975290 GAGAAAAACATTCCAGGAAGAGG - Intergenic
1059467022 9:114475481-114475503 GAGAAGGACACTCCTGAAAAGGG + Intronic
1059858171 9:118425123-118425145 CTGGAGGACATTTCTGGAGGAGG + Intergenic
1060000409 9:119953327-119953349 GAGGAGGTCATTCCAGGAAGAGG - Intergenic
1060102500 9:120852774-120852796 CAGAAGGGCATTCCAGGCAGAGG - Intergenic
1060208662 9:121697706-121697728 CAGAAGGCCATCCCAGGCAGTGG - Intronic
1060706340 9:125805186-125805208 GAGAAGAGCATTCCAGGAAGAGG + Intronic
1060720133 9:125971133-125971155 CAGAAGGACGTTCCAAGAACAGG - Intergenic
1060957726 9:127655690-127655712 CAGAAGCACAGTCCTGTAAATGG + Intronic
1061002657 9:127911034-127911056 GAGAAGAACATTCCAGGGAGAGG + Intronic
1061645434 9:131997282-131997304 CAGCAGGTTCTTCCTGGAAGAGG - Intronic
1061773597 9:132945798-132945820 GAGAAGGCCATTCCAGGCAGAGG + Intronic
1062070034 9:134550387-134550409 CTGAAGGTCATCCCTGGCAGTGG + Intergenic
1185696688 X:2200264-2200286 GAGAAGGACCATCCTGGAAGGGG - Intergenic
1186747132 X:12581783-12581805 GAGAAGGGCATTCTTGGCAGAGG - Intronic
1187995756 X:24924758-24924780 CAGAAGGATAGACCTGAAAGGGG + Intronic
1188415753 X:29931932-29931954 AAGAAGGAAATTCCTAGTAGAGG + Intronic
1189113096 X:38314198-38314220 CAGTAGGACCTTCCTTAAAGGGG + Intronic
1189245334 X:39558914-39558936 GAGAAGGATATTCCAGGCAGAGG - Intergenic
1190218954 X:48498695-48498717 AGGAAGGACATTCCTAGAAGTGG + Intergenic
1190471038 X:50779861-50779883 TGGAAGGACATTCCTGGAAGGGG + Intronic
1190677563 X:52795210-52795232 AAGAAAGACATTCCTGGTGGCGG + Intergenic
1192224307 X:69217772-69217794 CAGGAGGTCTTTTCTGGAAGTGG - Intergenic
1192357057 X:70413880-70413902 CAGAAGAACATTTCAGGAAAAGG + Intronic
1192978805 X:76316929-76316951 AAAAAGGAAATTCGTGGAAGTGG - Intergenic
1194087411 X:89546009-89546031 CAGAAGTACAATCTTGGGAGAGG - Intergenic
1195011790 X:100739465-100739487 GAGAAGGACATTCTTAGGAGGGG + Intergenic
1195111488 X:101655022-101655044 TAGAAGGGCATTCCAGGAGGGGG - Intergenic
1195778095 X:108430220-108430242 CAGAAGGATATTCCAGAGAGAGG + Intronic
1196143849 X:112295590-112295612 CAGAAGGACATAAGTAGAAGCGG - Intergenic
1196790136 X:119457285-119457307 GAGAAGAGCATTCCTGGCAGAGG + Intergenic
1197260033 X:124307620-124307642 CAGGAGGACATTTCAGAAAGAGG + Intronic
1200091599 X:153638645-153638667 GAGAAGCATGTTCCTGGAAGGGG + Intergenic
1200765250 Y:7075551-7075573 GTGAAGAACATTCCTGGATGAGG - Intronic