ID: 904829247

View in Genome Browser
Species Human (GRCh38)
Location 1:33296163-33296185
Sequence CCAAATGTCCATCTGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 390}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904829247_904829256 4 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829256 1:33296190-33296212 GACCTTTCCACTGTGGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 102
904829247_904829253 -3 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829253 1:33296183-33296205 TGGGCCGGACCTTTCCACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 134
904829247_904829261 20 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829261 1:33296206-33296228 GCGCTGGCCTGCACGTGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
904829247_904829254 -2 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
904829247_904829260 19 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829260 1:33296205-33296227 GGCGCTGGCCTGCACGTGGCAGG 0: 1
1: 0
2: 0
3: 26
4: 202
904829247_904829259 15 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829259 1:33296201-33296223 TGTGGGCGCTGGCCTGCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904829247 Original CRISPR CCAAATGTCCATCTGGACTA GGG (reversed) Intronic