ID: 904829249

View in Genome Browser
Species Human (GRCh38)
Location 1:33296164-33296186
Sequence CCCAAATGTCCATCTGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904829249_904829256 3 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829256 1:33296190-33296212 GACCTTTCCACTGTGGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 102
904829249_904829259 14 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829259 1:33296201-33296223 TGTGGGCGCTGGCCTGCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 152
904829249_904829253 -4 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829253 1:33296183-33296205 TGGGCCGGACCTTTCCACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 134
904829249_904829261 19 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829261 1:33296206-33296228 GCGCTGGCCTGCACGTGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
904829249_904829260 18 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829260 1:33296205-33296227 GGCGCTGGCCTGCACGTGGCAGG 0: 1
1: 0
2: 0
3: 26
4: 202
904829249_904829254 -3 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904829249 Original CRISPR CCCAAATGTCCATCTGGACT AGG (reversed) Intronic