ID: 904829252

View in Genome Browser
Species Human (GRCh38)
Location 1:33296170-33296192
Sequence GTCCGGCCCAAATGTCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904829252_904829259 8 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829259 1:33296201-33296223 TGTGGGCGCTGGCCTGCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 152
904829252_904829256 -3 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829256 1:33296190-33296212 GACCTTTCCACTGTGGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 102
904829252_904829253 -10 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829253 1:33296183-33296205 TGGGCCGGACCTTTCCACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 134
904829252_904829254 -9 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
904829252_904829261 13 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829261 1:33296206-33296228 GCGCTGGCCTGCACGTGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
904829252_904829260 12 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829260 1:33296205-33296227 GGCGCTGGCCTGCACGTGGCAGG 0: 1
1: 0
2: 0
3: 26
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904829252 Original CRISPR GTCCGGCCCAAATGTCCATC TGG (reversed) Intronic