ID: 904829254

View in Genome Browser
Species Human (GRCh38)
Location 1:33296184-33296206
Sequence GGGCCGGACCTTTCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904829249_904829254 -3 Left 904829249 1:33296164-33296186 CCTAGTCCAGATGGACATTTGGG 0: 1
1: 0
2: 2
3: 13
4: 154
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
904829247_904829254 -2 Left 904829247 1:33296163-33296185 CCCTAGTCCAGATGGACATTTGG 0: 1
1: 0
2: 1
3: 28
4: 390
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
904829252_904829254 -9 Left 904829252 1:33296170-33296192 CCAGATGGACATTTGGGCCGGAC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904829254 Original CRISPR GGGCCGGACCTTTCCACTGT GGG Intronic