ID: 904830532

View in Genome Browser
Species Human (GRCh38)
Location 1:33303703-33303725
Sequence GAGGGGTTCCAGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904830532_904830544 30 Left 904830532 1:33303703-33303725 CCTGCAGCTTCCTGGAACCCCTC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830532_904830540 8 Left 904830532 1:33303703-33303725 CCTGCAGCTTCCTGGAACCCCTC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904830532 Original CRISPR GAGGGGTTCCAGGAAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr