ID: 904830540

View in Genome Browser
Species Human (GRCh38)
Location 1:33303734-33303756
Sequence AGAAGATCCCCAACAACGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904830529_904830540 13 Left 904830529 1:33303698-33303720 CCCACCCTGCAGCTTCCTGGAAC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830534_904830540 -9 Left 904830534 1:33303720-33303742 CCCCTCCCTCCTCAAGAAGATCC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830526_904830540 24 Left 904830526 1:33303687-33303709 CCCAAGGGCTGCCCACCCTGCAG No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830527_904830540 23 Left 904830527 1:33303688-33303710 CCAAGGGCTGCCCACCCTGCAGC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830532_904830540 8 Left 904830532 1:33303703-33303725 CCTGCAGCTTCCTGGAACCCCTC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830535_904830540 -10 Left 904830535 1:33303721-33303743 CCCTCCCTCCTCAAGAAGATCCC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830525_904830540 29 Left 904830525 1:33303682-33303704 CCATTCCCAAGGGCTGCCCACCC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830531_904830540 9 Left 904830531 1:33303702-33303724 CCCTGCAGCTTCCTGGAACCCCT No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830530_904830540 12 Left 904830530 1:33303699-33303721 CCACCCTGCAGCTTCCTGGAACC No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data
904830533_904830540 -2 Left 904830533 1:33303713-33303735 CCTGGAACCCCTCCCTCCTCAAG No data
Right 904830540 1:33303734-33303756 AGAAGATCCCCAACAACGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904830540 Original CRISPR AGAAGATCCCCAACAACGCA AGG Intergenic
No off target data available for this crispr