ID: 904830544

View in Genome Browser
Species Human (GRCh38)
Location 1:33303756-33303778
Sequence GCTGCCTCCAGTCCACGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904830538_904830544 7 Left 904830538 1:33303726-33303748 CCTCCTCAAGAAGATCCCCAACA No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830542_904830544 -9 Left 904830542 1:33303742-33303764 CCCAACAACGCAAGGCTGCCTCC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830534_904830544 13 Left 904830534 1:33303720-33303742 CCCCTCCCTCCTCAAGAAGATCC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830539_904830544 4 Left 904830539 1:33303729-33303751 CCTCAAGAAGATCCCCAACAACG No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830543_904830544 -10 Left 904830543 1:33303743-33303765 CCAACAACGCAAGGCTGCCTCCA No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830532_904830544 30 Left 904830532 1:33303703-33303725 CCTGCAGCTTCCTGGAACCCCTC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830535_904830544 12 Left 904830535 1:33303721-33303743 CCCTCCCTCCTCAAGAAGATCCC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830541_904830544 -8 Left 904830541 1:33303741-33303763 CCCCAACAACGCAAGGCTGCCTC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830537_904830544 8 Left 904830537 1:33303725-33303747 CCCTCCTCAAGAAGATCCCCAAC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830536_904830544 11 Left 904830536 1:33303722-33303744 CCTCCCTCCTCAAGAAGATCCCC No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data
904830533_904830544 20 Left 904830533 1:33303713-33303735 CCTGGAACCCCTCCCTCCTCAAG No data
Right 904830544 1:33303756-33303778 GCTGCCTCCAGTCCACGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904830544 Original CRISPR GCTGCCTCCAGTCCACGCCT TGG Intergenic
No off target data available for this crispr