ID: 904831387

View in Genome Browser
Species Human (GRCh38)
Location 1:33308125-33308147
Sequence CTTTCAACTTAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904831371_904831387 21 Left 904831371 1:33308081-33308103 CCCCACACCCGGCCTTGGAACTC 0: 1
1: 0
2: 2
3: 7
4: 129
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831368_904831387 30 Left 904831368 1:33308072-33308094 CCTGGTCCTCCCCACACCCGGCC 0: 1
1: 0
2: 7
3: 64
4: 532
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831375_904831387 14 Left 904831375 1:33308088-33308110 CCCGGCCTTGGAACTCCGGACCC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831370_904831387 24 Left 904831370 1:33308078-33308100 CCTCCCCACACCCGGCCTTGGAA 0: 1
1: 0
2: 1
3: 31
4: 403
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831378_904831387 -1 Left 904831378 1:33308103-33308125 CCGGACCCTCTAGCCCTAGCATC 0: 1
1: 1
2: 0
3: 10
4: 111
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831379_904831387 -6 Left 904831379 1:33308108-33308130 CCCTCTAGCCCTAGCATCTTTCA 0: 1
1: 0
2: 0
3: 8
4: 150
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831376_904831387 13 Left 904831376 1:33308089-33308111 CCGGCCTTGGAACTCCGGACCCT 0: 1
1: 0
2: 0
3: 3
4: 138
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831380_904831387 -7 Left 904831380 1:33308109-33308131 CCTCTAGCCCTAGCATCTTTCAA 0: 1
1: 0
2: 0
3: 20
4: 173
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831377_904831387 9 Left 904831377 1:33308093-33308115 CCTTGGAACTCCGGACCCTCTAG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831373_904831387 19 Left 904831373 1:33308083-33308105 CCACACCCGGCCTTGGAACTCCG 0: 1
1: 0
2: 0
3: 12
4: 174
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150
904831372_904831387 20 Left 904831372 1:33308082-33308104 CCCACACCCGGCCTTGGAACTCC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904831387 Original CRISPR CTTTCAACTTAGATGGGGCA GGG Intronic
901314581 1:8297568-8297590 CTTTCTACTTACACGGGGCCTGG - Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
906104510 1:43283929-43283951 CTTTCAACTTAGAAGGGCCAGGG - Intronic
908181256 1:61608700-61608722 CTTTCTACTTAGTTGTTGCAAGG - Intergenic
908869088 1:68587480-68587502 CTTTGTACTTAGATGGTGCCTGG + Intergenic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
909193358 1:72583640-72583662 CTCTAAGCTTAGTTGGGGCAGGG - Intergenic
910778581 1:90901657-90901679 CTTACAACTTTCATGGGGGAGGG + Intergenic
914744809 1:150493864-150493886 CTCTGAACTTAGACTGGGCATGG + Intronic
916428166 1:164701498-164701520 CTATCAAATTTGCTGGGGCAAGG - Intronic
916505807 1:165427372-165427394 ATTCCAACATTGATGGGGCAAGG - Intronic
918134667 1:181661007-181661029 CATTTAAATTAGAAGGGGCAAGG + Intronic
923028050 1:230222344-230222366 CATTCAACTCTCATGGGGCAGGG - Intronic
1064936702 10:20686398-20686420 CTGTCAACTGAGATAAGGCAGGG + Intergenic
1066490312 10:35888023-35888045 CTTTCAGCTGAGAGGGGACATGG + Intergenic
1074490212 10:113933186-113933208 CTGTCCACTTAGTTGGGACAGGG + Intergenic
1080155313 11:29104069-29104091 CCATTAACTTAGATGGGGAAGGG - Intergenic
1081952284 11:47054591-47054613 CCTTCAAATAAGATGGGGCATGG - Intronic
1085120459 11:73964323-73964345 CTGTCAGCTGAGATGGGGGAGGG - Intronic
1087617087 11:100499292-100499314 TTATCAACTCAGATGGGGGAAGG + Intergenic
1089172841 11:116527447-116527469 GTTCCAACTCAGAAGGGGCAGGG - Intergenic
1089233346 11:117000630-117000652 CTTTCAGCTTGGTTTGGGCAAGG - Intronic
1089505888 11:118961594-118961616 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1093296239 12:17395537-17395559 CTATAAACTATGATGGGGCAGGG + Intergenic
1094021986 12:25924633-25924655 CTCTCAACTTCTATGGGGCCAGG + Intergenic
1094136243 12:27129920-27129942 CTTTCCACTTAGATGGTGAAGGG + Intergenic
1094185858 12:27641989-27642011 CTTTCCACTTAGATGGTGAAGGG + Intronic
1095042173 12:37455431-37455453 ATTCCAACTCAGAAGGGGCAGGG - Intergenic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1098309363 12:69133010-69133032 CATGCAACTTAGGTGGGGCCTGG - Intergenic
1098465809 12:70784277-70784299 CTGCCAACTTGGAAGGGGCAGGG + Intronic
1102999763 12:117376347-117376369 CTTTCAGCCTGGAAGGGGCACGG + Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1104451214 12:128869463-128869485 ATTTCAAAATAGATGGGGCTGGG - Intronic
1106539667 13:30678996-30679018 TTTTAAAATTAGGTGGGGCATGG + Intergenic
1108088157 13:46817976-46817998 GTTCCAACTCAGAAGGGGCAGGG - Intergenic
1109555997 13:63976419-63976441 CTTCCAACTTAGTTGGAACATGG - Intergenic
1111654187 13:91131758-91131780 TTTTGAACTTATATGAGGCAAGG - Intergenic
1119567621 14:75641957-75641979 GTGGCAACATAGATGGGGCAGGG + Intronic
1121893411 14:97621031-97621053 CTTCTGACTCAGATGGGGCAAGG + Intergenic
1124698819 15:31893230-31893252 GTGTCAACTTAAATGGGCCATGG - Intergenic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1128591988 15:68906281-68906303 TTTTCAACTCAGAATGGGCAAGG + Intronic
1129242455 15:74259586-74259608 CCTTCATATTAGATGGGGCAGGG + Intronic
1129331557 15:74830450-74830472 CTTGGAACTAGGATGGGGCAAGG - Exonic
1130029081 15:80295506-80295528 CCTGCAACTCAGAAGGGGCAGGG + Intergenic
1130402903 15:83573965-83573987 CTTTCAGCCTGGATGGGTCAGGG + Intronic
1130444513 15:83987846-83987868 CTATGAAGTGAGATGGGGCAGGG + Intronic
1130829278 15:87583146-87583168 CTTGCAAAGTAGAAGGGGCAGGG - Intergenic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1131408580 15:92186765-92186787 CTTTCAACTCATATAAGGCATGG - Intergenic
1131869154 15:96743794-96743816 CTTTAAACCTAGCTGGGGAATGG + Intergenic
1132305210 15:100807276-100807298 CCATCAACTCAGAAGGGGCAGGG - Intergenic
1132978895 16:2724871-2724893 CTGCCAACTCAGAAGGGGCAGGG - Intergenic
1134313379 16:13096463-13096485 CATTCAACCTAGCTGGGGCTGGG + Intronic
1135953713 16:26938441-26938463 CCTCCAACTTAAATGGGGCCAGG + Intergenic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138468496 16:57212014-57212036 CCTTCAACTCTGTTGGGGCAGGG + Intronic
1139326240 16:66154699-66154721 CTTTCAAGGTGGCTGGGGCAGGG - Intergenic
1139717521 16:68825434-68825456 TTTTCAATTTAGATTGAGCATGG + Intronic
1146443227 17:32915314-32915336 CTTTCAGCTTATATGTGGGAAGG - Intergenic
1146459352 17:33033439-33033461 CTGCCAACTTGGAAGGGGCAGGG - Intronic
1151155747 17:72122211-72122233 CTGTCCACGGAGATGGGGCAAGG + Intronic
1151216308 17:72579063-72579085 CGTGCAGCTCAGATGGGGCAAGG + Intergenic
1151272912 17:73010876-73010898 CTTTCAACTTCGATGCCGTAAGG + Intronic
1151973059 17:77468947-77468969 CTGTTCACTTAGATGGGGGATGG + Intronic
1151998894 17:77632290-77632312 ATATTAACTTAAATGGGGCATGG + Intergenic
1153624813 18:7013674-7013696 CTTTGAACTCAGATGCGGAAGGG + Intronic
1158608353 18:58916059-58916081 CTTTCAACCCTGGTGGGGCAGGG + Intronic
1159477719 18:68944506-68944528 CTTGCATGTTAGAAGGGGCAAGG + Intronic
1166602993 19:44114089-44114111 CATTTAACTTTTATGGGGCACGG + Intronic
1168133045 19:54332844-54332866 CTTTGAACTTAGAGAGGACAGGG + Intergenic
927130639 2:20055757-20055779 CTTTCCTCTTGGATGGGTCATGG - Intergenic
928385508 2:30864278-30864300 CTTCCAACTCAGATGTGCCATGG + Intergenic
932341793 2:70967266-70967288 ATTTCACTGTAGATGGGGCAGGG - Intronic
934937001 2:98472803-98472825 CTTGCAGCTTAGCTGGGGCATGG + Intronic
937060149 2:118974793-118974815 CCTTCATCCTAGATGGGGCTGGG + Intronic
937500401 2:122472178-122472200 CTTGAAAGTTAGATGGGGCTGGG + Intergenic
942103923 2:172614058-172614080 CCATCAACTTGGAAGGGGCAGGG - Intergenic
943116229 2:183674548-183674570 CTTTCAACTTTGGTGAGGTAAGG - Intergenic
946654099 2:221926577-221926599 CTGCCAAGTTAGATGGGGTAGGG + Intergenic
946878181 2:224151015-224151037 CTTTCATGTTGGAAGGGGCAAGG - Intergenic
948014865 2:234680256-234680278 CTGTGAACTTGGCTGGGGCATGG - Intergenic
1168989878 20:2085917-2085939 CTTACAAGTGAGTTGGGGCAAGG + Intergenic
1169182264 20:3579967-3579989 AGTGCAACTTAGATGGGGTATGG + Intronic
1171536605 20:25898503-25898525 ATTCCAACTCAGAAGGGGCAGGG - Intergenic
1171804500 20:29662654-29662676 ATTCCAACTCAGAAGGGGCAGGG + Intergenic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1177736096 21:25092431-25092453 CCATCAACTGAGAAGGGGCAGGG + Intergenic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1178860799 21:36287445-36287467 CTTTCTACTCAGCTGTGGCAGGG + Intronic
1182491251 22:30673478-30673500 CGTACACCTTAGGTGGGGCAAGG + Intergenic
1184173750 22:42774507-42774529 CTTGCAACTCAGAAGGGGCAGGG - Intergenic
949161066 3:882576-882598 TTTTCATTTTAGCTGGGGCAGGG - Intergenic
950734408 3:14993788-14993810 CTTTTACCTGAGAGGGGGCATGG - Intronic
952269471 3:31817450-31817472 CCATCAACTCAGAAGGGGCAGGG + Intronic
956105665 3:65815462-65815484 CTTTCAAGTGAGCTGGGGGAGGG - Intronic
957095191 3:75771719-75771741 CTGCCAATTTAGAAGGGGCAGGG - Intronic
964478240 3:157116446-157116468 CCTTCAAGTTAGATAGGGCCAGG - Intergenic
965118739 3:164522646-164522668 CCTTCAACTCAGAGGGGGCCAGG + Intergenic
967408971 3:189148251-189148273 CTCTAAACTTAGAAGGGGCCAGG + Intronic
968343113 3:197975772-197975794 CTTTCTATTTAAATGGGGCTAGG + Intronic
968741927 4:2335463-2335485 CTGTCACCCTAGATAGGGCAAGG - Intronic
970772320 4:19628658-19628680 CTTACAACTTAGATCTGGGAGGG + Intergenic
970772449 4:19630165-19630187 CTTACAACTTAGATCTGGGAGGG + Intergenic
973535458 4:51877356-51877378 CTTACAAGTTAGACTGGGCACGG - Intronic
974688486 4:65265205-65265227 GTTTCAACTTGGTTGGGCCATGG + Intergenic
976430634 4:84960104-84960126 ATTTCAACTGAGATTGGGTAGGG + Intronic
977811430 4:101359979-101360001 CTTTCAACCTAGATTAGGAAAGG - Intergenic
979605907 4:122638861-122638883 CATCCAACTAAGAAGGGGCAGGG + Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
982104420 4:151999229-151999251 TTTTGTACTTAGATGGGACAGGG + Intergenic
982288181 4:153756414-153756436 CTATTAACTGAGATGGGGGATGG - Intronic
987970667 5:24939684-24939706 CATTCACCTTAGATGTGGAAGGG + Intergenic
990639056 5:57761878-57761900 CCACCAACTTAGAAGGGGCAGGG - Intergenic
991037630 5:62144045-62144067 CTTTCTGCTTAGCTGGGGAATGG - Intergenic
991359451 5:65803792-65803814 CTGCCAACTTAGAAGGGGGAAGG + Intronic
991469558 5:66953668-66953690 CATTGCACTTAAATGGGGCAAGG - Intronic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
994327994 5:98471475-98471497 CTTTCAACTTAAATGTAGGAAGG + Intergenic
995005660 5:107192263-107192285 CTTTAAACTTAGAGGGCTCAAGG + Intergenic
995755744 5:115502201-115502223 TTGTCAACTTAGCTGGGCCATGG + Intergenic
996286292 5:121797009-121797031 CTGTCAACTTTGCTGGGCCATGG - Intergenic
997258413 5:132446824-132446846 CTTTGCACTTAGATGGCCCAAGG + Intronic
999799588 5:155020173-155020195 GTCTCAACTCAGAAGGGGCAGGG + Intergenic
1000750927 5:165096464-165096486 CTTTTTACTTTGCTGGGGCATGG - Intergenic
1001669679 5:173463360-173463382 CCTTCAGCTTGGATGGGCCATGG + Intergenic
1002694283 5:181073791-181073813 CCTCCCACTTAGATGTGGCAGGG - Intergenic
1009662001 6:66625700-66625722 ATTGCAACTTAGATGGGCCAAGG - Intergenic
1015175482 6:130302915-130302937 CTTTAAAATTTGAGGGGGCAAGG + Intronic
1016495917 6:144661542-144661564 CTCTCCACTTAGAAGGGGCGGGG + Intronic
1018397997 6:163395248-163395270 CTTTAAACTTAGATAGAGCCAGG + Intergenic
1019066292 6:169302158-169302180 CATGCAGCTTTGATGGGGCATGG - Intergenic
1021339076 7:19440675-19440697 CTTTCAAGATTGGTGGGGCAAGG - Intergenic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026359709 7:69591849-69591871 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1027651136 7:80870207-80870229 CTTCCCACTCAGGTGGGGCAAGG - Intronic
1028743297 7:94300719-94300741 CTTGTAACCTTGATGGGGCAGGG - Intergenic
1032919371 7:136527970-136527992 CTTTCAACTCAGAAGGGGGCTGG + Intergenic
1033471513 7:141653756-141653778 ATATCAACTTAGATGGGTGAGGG - Exonic
1035740549 8:1925058-1925080 CCTGCCACTTAGATGGGGCCAGG + Intronic
1038047835 8:23781233-23781255 GTTTCAACTTGAATGGGCCATGG - Intergenic
1041573019 8:59359049-59359071 CTCTTAACTTAGATGGTGGAAGG + Intergenic
1042651895 8:71052318-71052340 CCTTCAACTGAGTTGGGGTAAGG + Intergenic
1044308018 8:90659845-90659867 CATTCAACTCAGATGGGGAATGG - Intronic
1044865240 8:96564342-96564364 CTTTCAACTTTGCAGGGGGATGG + Intronic
1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG + Intergenic
1046570379 8:115956872-115956894 CTCTCACCTTCCATGGGGCAGGG + Intergenic
1046681700 8:117177696-117177718 ATTTCAACTTGGATGGGGAAAGG + Intergenic
1049934756 9:491113-491135 TTTAAAAATTAGATGGGGCATGG - Intronic
1052242844 9:26295368-26295390 CTTTGAAATTAGATGGTGCTTGG + Intergenic
1056272103 9:84956199-84956221 CTTTCAACCAAGATGGCGCTTGG - Intronic
1057584052 9:96313838-96313860 CTTCCAAGTGAGCTGGGGCAAGG + Intergenic
1058806053 9:108593264-108593286 ATTTCAATATAGATTGGGCATGG - Intergenic
1060200835 9:121651207-121651229 CTTTCAACCTGGCTGGGCCAGGG + Intronic
1062706772 9:137949897-137949919 GTGTCAACTTAGCTGGGCCACGG - Intronic
1186334914 X:8575951-8575973 ATTTTAAATTAGCTGGGGCATGG + Intronic
1187286744 X:17912577-17912599 CTTCAGACTTTGATGGGGCAGGG - Intergenic
1189704995 X:43750894-43750916 CTTTCACCTTAGAAAGGGCAGGG + Intergenic
1197972390 X:132129226-132129248 ATGTCAACTTAGATGGGTGAGGG + Intergenic
1201500870 Y:14641196-14641218 ATATCAACTTAGATGGGTAAGGG - Intronic