ID: 904832084

View in Genome Browser
Species Human (GRCh38)
Location 1:33311848-33311870
Sequence GCTCTATGGTGTTGGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904832071_904832084 26 Left 904832071 1:33311799-33311821 CCCTTCCAGATGTGGTTCTAGAA 0: 1
1: 0
2: 1
3: 20
4: 159
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121
904832077_904832084 0 Left 904832077 1:33311825-33311847 CCCTGGCTGCCTGTGTTGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121
904832073_904832084 21 Left 904832073 1:33311804-33311826 CCAGATGTGGTTCTAGAACAGCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121
904832079_904832084 -1 Left 904832079 1:33311826-33311848 CCTGGCTGCCTGTGTTGGGCGGG 0: 1
1: 0
2: 0
3: 20
4: 216
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121
904832072_904832084 25 Left 904832072 1:33311800-33311822 CCTTCCAGATGTGGTTCTAGAAC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121
904832081_904832084 -9 Left 904832081 1:33311834-33311856 CCTGTGTTGGGCGGGCTCTATGG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904832084 Original CRISPR GCTCTATGGTGTTGGTGTCC AGG Intronic
901071257 1:6519911-6519933 TCTCTGTGGTGTTGCTTTCCTGG - Intronic
901743920 1:11360069-11360091 GCTCCCTGGTGTGGGTGTCATGG + Intergenic
901950912 1:12745581-12745603 GCTCTGTGGGGATGGTGCCCAGG + Intergenic
902245124 1:15115638-15115660 GCTCTGTGGAGTTTGTGTCTCGG - Exonic
904393354 1:30199943-30199965 GCTCTGTGGTGGTTGTTTCCTGG + Intergenic
904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG + Intronic
906581794 1:46941160-46941182 GCTCTATGGATTTTGTGACCAGG + Intronic
906601922 1:47137737-47137759 GCTCTATGGATTTTGTGACCAGG - Intronic
912949363 1:114110184-114110206 GGTCTCTGGTGTGGGTGTCTGGG - Intronic
913326095 1:117630174-117630196 GTTCAATTGTGTTAGTGTCCGGG - Intergenic
916492573 1:165314938-165314960 CCTCTGGGGTGTTGGTGTTCAGG - Intronic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1068252638 10:54463723-54463745 CCTCTATGGGGTAGGTGTCATGG - Intronic
1069276834 10:66602611-66602633 TCTCTCTGGTGTTGGTATCAGGG - Intronic
1070972093 10:80576074-80576096 GCTCTGTGGAGCTGGAGTCCTGG + Intronic
1073131255 10:101190455-101190477 GTTCAATATTGTTGGTGTCCAGG - Intergenic
1073184859 10:101609756-101609778 GCTTTATGTTGTAGGTCTCCGGG - Intergenic
1076693104 10:132233707-132233729 GCTGTCAGGTGTTGGTGGCCAGG + Intronic
1076998389 11:310508-310530 GCTCTGTGGTGCTGGGGACCTGG + Intronic
1077000353 11:319250-319272 GCTCTGTGGTGCTGGGGACCTGG - Intergenic
1084327754 11:68411583-68411605 ACTCGATCATGTTGGTGTCCAGG - Exonic
1084768580 11:71327913-71327935 CCTCTGTGGTGTTGGCTTCCAGG + Intergenic
1085040643 11:73324445-73324467 GCCCTATGTTGCTGCTGTCCTGG + Intronic
1091138117 11:133211210-133211232 GCTTTCTGGTGATGGTTTCCTGG + Intronic
1095201192 12:39386356-39386378 GTACCATTGTGTTGGTGTCCCGG - Intronic
1096816646 12:54205897-54205919 GCTCTGTGGTGTGGTTGCCCTGG + Intergenic
1103055849 12:117819498-117819520 GATTTATGGTGATGGTTTCCTGG + Intronic
1103564824 12:121810313-121810335 GCTCCATGCTGTTGGTGTCGGGG - Exonic
1104991504 12:132626287-132626309 GGTTTGTGATGTTGGTGTCCAGG + Exonic
1119536766 14:75409184-75409206 GCACTATGGGGTTGCTGTCATGG - Intergenic
1122066607 14:99178130-99178152 GGTTTCTAGTGTTGGTGTCCTGG - Intronic
1202858320 14_GL000225v1_random:64792-64814 GCTCTCTGCTGTTGATGTACGGG + Intergenic
1127201238 15:56654025-56654047 GCTCTATGGAGCTCGTGACCTGG - Intronic
1127310841 15:57750918-57750940 GATCTATGGTGTTGCTCTCTTGG + Intronic
1127572182 15:60254479-60254501 TGACTATGGTGTTGGTGTTCAGG - Intergenic
1128308579 15:66616247-66616269 GCTCTCTGTAGTTGATGTCCAGG - Intronic
1131807473 15:96137549-96137571 GCTCTATTGTGCTGGAGTGCAGG + Intergenic
1138333093 16:56230946-56230968 GGTCTGTGGAGTTGGTGCCCTGG + Intronic
1139737418 16:69003393-69003415 GCTCTTTTGTGATGGTGGCCTGG - Intronic
1147441518 17:40450374-40450396 GCCCCCTGGTGTTAGTGTCCTGG + Intronic
1150284668 17:63948134-63948156 GCTCTATGCTGCTGGTTCCCGGG + Intronic
1152394641 17:80025153-80025175 TGTCTATGGTGTGTGTGTCCTGG - Intronic
1154494961 18:14948936-14948958 CCTCTGTGGTGTTGCTGTCTGGG - Intergenic
1155258268 18:24016983-24017005 GAACTATAGTGTTTGTGTCCTGG - Intronic
1159020056 18:63135995-63136017 CCTCAGTGGTCTTGGTGTCCGGG - Intronic
1161325456 19:3661568-3661590 GTTCCATGGTGTTGGGGTCCTGG - Intronic
1161723335 19:5915404-5915426 GCTCTGTGGTGTGGCTGCCCAGG - Exonic
1162908937 19:13839401-13839423 GCTCTTGGGAGATGGTGTCCAGG + Intergenic
1163168578 19:15514929-15514951 TCTCTCTGGTGTGGCTGTCCAGG + Intronic
1167209331 19:48123207-48123229 GCTCGATGTCCTTGGTGTCCAGG + Exonic
925398804 2:3557371-3557393 GCCTTATGGTGCTGGTGTGCTGG - Intronic
927947260 2:27143302-27143324 GGTCTTTGGTTTTGGTGTCAGGG + Intergenic
932659616 2:73641085-73641107 GCTGGATGGTGCCGGTGTCCAGG + Exonic
932666180 2:73700762-73700784 GCTGGATGTTGCTGGTGTCCAGG + Intergenic
933917954 2:87015562-87015584 CCTCTACTGTGTTGGTGGCCAGG - Intronic
934005041 2:87754352-87754374 CCTCTACTGTGTTGGTGGCCAGG + Intronic
935518868 2:104078818-104078840 GCTCTGTGGTGCTGGAGGCCTGG + Intergenic
935768001 2:106388384-106388406 CCTCTACTGTGTTGGTGGCCAGG + Intergenic
938181854 2:129191314-129191336 CCTCTATGCTGTGGGTGACCTGG + Intergenic
940735977 2:157453032-157453054 GCTGTTTGGTGTTGGTTTACAGG + Intronic
946635209 2:221717462-221717484 GCGGTAGGGTTTTGGTGTCCTGG - Intergenic
947191311 2:227508223-227508245 ACTCTATTGTCTTGTTGTCCTGG - Intronic
947774455 2:232697055-232697077 GTTGAGTGGTGTTGGTGTCCAGG - Intergenic
1169712061 20:8575583-8575605 GCTCTAGGGTTTTGGTGGACAGG + Intronic
1170714497 20:18820130-18820152 CCTCTTTGGTGGTGCTGTCCTGG - Intronic
1171491328 20:25520081-25520103 AATCTCTGATGTTGGTGTCCAGG + Intronic
1172482580 20:35279651-35279673 GCTCTGTGCTGGTTGTGTCCAGG + Exonic
1174375177 20:50121834-50121856 CCACTGTGGTGTTGGTTTCCAGG - Intronic
1175975873 20:62710143-62710165 CCTCTCTGGTGTTGGTGGCTGGG + Intronic
1177497668 21:21910490-21910512 GCTCTGTGGTGCTGGTGCCCAGG - Intergenic
1177587488 21:23117374-23117396 GCTCTATGTTGTTTTTTTCCAGG + Intergenic
1177994840 21:28084253-28084275 GCTCTCTGGTGAAGGTTTCCCGG + Intergenic
1179302394 21:40124264-40124286 CCTCCATGGTCTTTGTGTCCTGG - Exonic
1179561842 21:42220178-42220200 CCTCTACGATGTTGGTGTGCTGG - Intronic
1180036796 21:45254230-45254252 GCTGTGTGGGGTTGGGGTCCTGG - Intergenic
1180894873 22:19323275-19323297 GGTCTTTGGTTTTGGTGTCAGGG - Intergenic
1182909255 22:33967213-33967235 GCCCTATGTTGTTGGGTTCCTGG - Intergenic
1183547183 22:38460608-38460630 GCTCCATGGTGTGTGTGTGCAGG - Intergenic
1184302577 22:43570895-43570917 GCTCCATGGTGGGGGAGTCCAGG - Intronic
952989800 3:38821756-38821778 GATGTATCGTGTTGGTGGCCAGG - Intergenic
955095682 3:55795655-55795677 CCTCTATGGTTTTGGTTTCTTGG - Intronic
955586019 3:60479011-60479033 GTTCTACAGTGTTGCTGTCCTGG - Intronic
957375605 3:79353693-79353715 GGGCTATGGTGTTGGTGTGGAGG + Intronic
963723204 3:148887869-148887891 GCTCAATGATAATGGTGTCCTGG + Intronic
963760291 3:149281385-149281407 GCTGTCTGATGTTGGTGTTCTGG - Intergenic
965782123 3:172296885-172296907 GCTCTGTGGGGGTGGGGTCCTGG + Intronic
968135897 3:196219297-196219319 TCTCAATGTTTTTGGTGTCCGGG - Intronic
968393407 4:211699-211721 GCTCTTTGGTGCTGGTGTGGTGG - Intergenic
968644224 4:1730937-1730959 GCTCTCTGCTGTTGGGGTCTCGG - Exonic
970464399 4:16308195-16308217 GCTCTATGGTGGTGGTATCTTGG - Intergenic
971442683 4:26705794-26705816 GGTCTTTGGTGTTGGTATCAAGG + Intronic
976001839 4:80383398-80383420 GCTCAATGGTTTTGTTGTTCTGG - Intronic
976493826 4:85703174-85703196 AGTCTATGGTCTTGGTGACCAGG - Intronic
978460843 4:108950315-108950337 TCTCTGTGGTGTTGCTTTCCTGG - Intronic
987947303 5:24628239-24628261 AGTCTATGCTGTTGGTGTTCTGG - Intronic
990190104 5:53250011-53250033 GCTTTATGGGGTTGGTGTCAGGG - Intergenic
990366072 5:55071193-55071215 GAGCAATGGTTTTGGTGTCCTGG + Intergenic
991086386 5:62651743-62651765 CTTCTATGGTGTTGGCTTCCTGG + Intergenic
995213042 5:109562259-109562281 GTTCTCTGGTGCTGCTGTCCTGG + Intergenic
996841519 5:127852107-127852129 GCTCTCTGGGGTTGGTATCGTGG - Intergenic
1000192592 5:158925660-158925682 GCTCTGTGATGTTGGGGCCCTGG - Intronic
1003056359 6:2824386-2824408 GCTCTGTGGTGTGGGTAACCAGG + Intergenic
1004026390 6:11823308-11823330 GGTCAATGGTGTTGCTGACCCGG + Intergenic
1005297135 6:24437455-24437477 GCTCTCTGGTGTTTGTGCCTTGG - Intronic
1007683595 6:43651195-43651217 ACCCTATGGAGTTGGTTTCCAGG + Intronic
1015439771 6:133234331-133234353 GCTGTATTGTGTTCATGTCCTGG - Intergenic
1019879124 7:3842685-3842707 GGTCTAGGGTGCTGGTGTCATGG - Intronic
1021279055 7:18694444-18694466 GCTAAATGGGGTTGGTGTCTCGG + Intronic
1023527121 7:41116525-41116547 GCTCTGTGGTGTGGGAATCCAGG - Intergenic
1024603951 7:51010075-51010097 CCTCCATGCTGTGGGTGTCCTGG + Intergenic
1028552507 7:92085473-92085495 GCTCTTGGGTTTTGGTTTCCAGG + Exonic
1032511921 7:132479452-132479474 GCTCTATTTTGTTGGCTTCCTGG - Intronic
1033159482 7:138982833-138982855 GATCTATGGCCATGGTGTCCTGG - Intergenic
1033226460 7:139566888-139566910 CCTCTCTGGTGCTGGTGTTCTGG + Exonic
1035662468 8:1358620-1358642 GCTCTTTGATGTTGGTGTTGAGG + Intergenic
1038840235 8:31177844-31177866 GATCTAGGGTGCTGGGGTCCTGG - Intergenic
1049671777 8:143873199-143873221 GCTCTGTGCTGTTGGTGCCTGGG + Exonic
1052707444 9:32010633-32010655 GCTCTATGGAGTGGGAGGCCTGG - Intergenic
1057514548 9:95710490-95710512 GCTGCATGGTGTTGGTTGCCTGG + Intergenic
1058194900 9:101960564-101960586 GCTCTATAGAGTTTCTGTCCTGG + Intergenic
1059312570 9:113398766-113398788 ACTCTATGGTGTAGGTATCAGGG - Intronic
1060985892 9:127818739-127818761 GCTCGATGGTGTTGGAGGCCTGG + Exonic
1061198371 9:129121315-129121337 GCTGTAGGGTGTGGGTCTCCTGG - Intronic
1188934300 X:36154328-36154350 GCTAAATGGTGTTTGTGTCCTGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191158685 X:57303366-57303388 GCTCTATGGTTTGGGTGACATGG + Intronic
1192277843 X:69651444-69651466 GCTTTCTGGTATTGGTATCCAGG + Intronic
1195942916 X:110180032-110180054 GCTCTATATAGTTGGTGTCCTGG + Intronic
1199368161 X:147013115-147013137 GATGTCTGGTGTTGGTGTCTGGG + Intergenic
1199715381 X:150504020-150504042 CCTCTAGGGTGTGGGAGTCCTGG - Intronic