ID: 904834486

View in Genome Browser
Species Human (GRCh38)
Location 1:33326107-33326129
Sequence ATTTTCAGGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904834482_904834486 7 Left 904834482 1:33326077-33326099 CCTCATGAAGTGGGTGGTCTAGC 0: 1
1: 0
2: 2
3: 10
4: 89
Right 904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG 0: 1
1: 1
2: 5
3: 35
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904834486 Original CRISPR ATTTTCAGGCAGAATGTGGA AGG Intronic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905352387 1:37356630-37356652 ATCTTCAGGCAGAGTATGGTGGG + Intergenic
905967275 1:42109398-42109420 ATTTTCAGGGAGATTGTAAAAGG + Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906911324 1:49954470-49954492 ATCTTATGGCAGAAGGTGGAAGG - Intronic
908066571 1:60412589-60412611 AATTTCAAGCAGCATGTGAATGG - Intergenic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
911469948 1:98305918-98305940 AATTTCAGGCAGAGTGAGGCTGG - Intergenic
911841712 1:102690215-102690237 ATTTTTAGGCAAAAAGAGGAAGG + Intergenic
912583810 1:110743444-110743466 ATATTCAGGAACACTGTGGATGG + Intergenic
912683513 1:111743868-111743890 ATGATCAGGCAGCATGTGGTGGG - Intronic
913056469 1:115166074-115166096 ATTTCCAGCCAGAGTGTTGAGGG - Intergenic
914097123 1:144553544-144553566 ATTTTCAAGCAGAACATGAAAGG - Intergenic
914301871 1:146384066-146384088 ATTTTCAAGCAGAACATGAAAGG + Intergenic
915297077 1:154929043-154929065 TTTTGCAGGAAGATTGTGGAGGG - Exonic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916038128 1:160938997-160939019 ATTTAAAGGCAGTGTGTGGAGGG - Intergenic
916431078 1:164729098-164729120 ATTTTCAAGCAGAATTTTCAAGG + Intronic
916524539 1:165597484-165597506 GTTTTCTGTCAGAAGGTGGAGGG - Intergenic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
917317785 1:173744532-173744554 ATTTTGAGGCAGAGTTTGAAAGG + Intronic
917731477 1:177879283-177879305 GTTTTGAGGAAGAATGGGGAGGG + Intergenic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
918181094 1:182086484-182086506 ACTTTCTGGCAGAGTGTAGATGG - Intergenic
918563742 1:185900985-185901007 ACTTTCAGACAGAAGTTGGATGG - Intronic
919781925 1:201226745-201226767 ATTTGCAGGCAAGATGTGGCAGG + Intronic
920968311 1:210720505-210720527 AGTCTCAGGAAGAATGTGGAAGG + Intronic
923737318 1:236622924-236622946 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
1063514516 10:6681935-6681957 TTTTTCAGGCAGAAAGAGGAAGG + Intergenic
1063696024 10:8335804-8335826 ATTTGCAGGAAAAATGTGGTAGG + Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1064129586 10:12697127-12697149 ATTTTCACCCAGAATTTAGAGGG + Intronic
1064474984 10:15678277-15678299 ATGTTCAGTAAGAATGTAGAGGG - Intronic
1065269059 10:24008096-24008118 TCTTGCAGGCAGAATGTTGAGGG - Intronic
1065314636 10:24451345-24451367 ATGTTAAGGCTGAAGGTGGAGGG + Intronic
1066457354 10:35584072-35584094 ATGTACAGGCAGAATGTGATTGG - Intergenic
1066501055 10:35995141-35995163 ATTTCCAGGTAGACTGTGAATGG + Intergenic
1066628929 10:37439400-37439422 ATTTCCAGGTAGACTGTGAATGG + Intergenic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1068170985 10:53394386-53394408 ATAATCAGGCAGAATGAGGATGG - Intergenic
1069583409 10:69580192-69580214 ATGTTCATGCAGAATTTTGAAGG + Intergenic
1071214482 10:83384021-83384043 ATTATTTGGCATAATGTGGATGG - Intergenic
1071345736 10:84690424-84690446 ATTTTCAGGTAAAATATGGAAGG + Intergenic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1077652647 11:3987452-3987474 AGTCTCAGGCAGTATGGGGATGG + Intronic
1078397550 11:10994615-10994637 ATTTCCAGGCAGAGTGTTGAAGG - Intergenic
1079069683 11:17333250-17333272 ATTTTCAGACACAATCTGAATGG + Intronic
1079737011 11:24010034-24010056 ATGCTCAGGCAGACTGTTGAAGG + Intergenic
1079922267 11:26447568-26447590 AGTTTCAGGCAGAAAGTACAAGG + Intronic
1080113180 11:28592744-28592766 GTTTCCAGGCAGAGTGTTGAAGG - Intergenic
1080390141 11:31837945-31837967 GTTTTCAGGGAGAGTTTGGATGG + Intronic
1081189855 11:40090333-40090355 ATATTCTGGCACAATGTGAAAGG - Intergenic
1081473360 11:43398850-43398872 TTTTTAAGGCATAATGTGGTAGG + Intronic
1082569893 11:54726020-54726042 ATATCCAGACCGAATGTGGATGG + Intergenic
1082720355 11:56667636-56667658 CTTTTCAGCCAGTATGTTGAAGG - Intergenic
1083180446 11:60981758-60981780 ATTTTCAGGCAGAAGGCGTTCGG - Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1088190688 11:107225085-107225107 ATTTTCAGGCTGGAAATGGAAGG - Intergenic
1088223714 11:107595391-107595413 ATTATAAGGCAGAATGTGTTTGG - Intronic
1088885753 11:114005173-114005195 ACTTTCAGGAAAAATGTGGATGG - Intergenic
1089272959 11:117314740-117314762 ATTGTCAGGAAGGATGGGGAGGG + Intronic
1089323804 11:117643905-117643927 ATTCTCAGACAGAAGGTGGCAGG + Intronic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1089832221 11:121338666-121338688 ATTTTCGGCTAGATTGTGGAGGG - Intergenic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1090479115 11:127052434-127052456 ATTTTCAGGCAGACAGTATAAGG + Intergenic
1090540506 11:127698178-127698200 ATTCTCAGGCTAACTGTGGAGGG - Intergenic
1091181731 11:133611011-133611033 ATTTGCAGGCAGAAGGTAAAAGG - Intergenic
1091922682 12:4318461-4318483 ATTTTCAGGATGAGAGTGGAGGG - Intergenic
1092191252 12:6522707-6522729 ATTCTCAGGGAAAATGCGGAAGG + Intronic
1096107907 12:49008726-49008748 GTTTTCCTGCAGAATGTTGAAGG + Intronic
1096301535 12:50432542-50432564 ATTTTCAAGCAGTATGGGGTAGG - Intronic
1098074054 12:66707661-66707683 ATATGCAGGAAGGATGTGGAGGG - Intronic
1098292169 12:68967027-68967049 ATTATCAGCCAGACTGTTGAAGG + Intronic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1100251546 12:92829995-92830017 ATTTTTAGGGAGAGTGTGGGGGG + Intronic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1100595858 12:96071506-96071528 AATTTCAGACAGAATGCAGAAGG + Intergenic
1101557524 12:105824292-105824314 ATCTGCTGGAAGAATGTGGAGGG + Intergenic
1102607050 12:114075985-114076007 TGTATCAGGCACAATGTGGAGGG + Intergenic
1103011044 12:117458634-117458656 ATTATCGGGCAGAAGTTGGATGG + Exonic
1103160053 12:118721270-118721292 ATTTTCACCCAGAATGGGGTAGG - Intergenic
1103454095 12:121051155-121051177 ATATGCAGGGAGAATTTGGAGGG + Intergenic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1104343106 12:127969873-127969895 AATTTCAGGCAAAATGTAAAGGG + Intergenic
1105594633 13:21825596-21825618 ATTTTCTGGCAGGATGTCAAAGG - Intergenic
1105814546 13:24022709-24022731 GTTTTCTGGCAGCATGTGGGAGG + Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1106543085 13:30707347-30707369 ATTTTCTGGCAGCATGGGAAGGG - Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1107468322 13:40667961-40667983 TTTTTTAGGAAGAATATGGAAGG + Intergenic
1108766240 13:53633243-53633265 ATTTTTAGGCAGATTGGGAAAGG + Intergenic
1109303188 13:60610715-60610737 ATTTTCACTCAGAATTTTGAAGG + Intergenic
1109512615 13:63399706-63399728 ATTTTCAGATAAAGTGTGGAGGG + Intergenic
1110017338 13:70424229-70424251 ATTTTAAGGCAGAATTTGAAAGG + Intergenic
1110189791 13:72717226-72717248 ATTTCCAAGCAAATTGTGGAAGG - Intronic
1110208593 13:72946903-72946925 CTTTTCAGGCAGACAGTGCAAGG + Intronic
1112144016 13:96678092-96678114 ATTCCCTGGCAGAAAGTGGAAGG + Intronic
1112210412 13:97371598-97371620 ATTTTCAAGCAGAATAGTGATGG + Intronic
1112780818 13:102898754-102898776 ATTTTTAGGTAGAATATGTAAGG + Intergenic
1114276412 14:21149629-21149651 ATTTTCAAGCAGAATGTTTAAGG - Intergenic
1114700546 14:24673865-24673887 ACTTTCAGGAATTATGTGGAAGG + Intergenic
1114947936 14:27710571-27710593 ATTTTCAGACAGAATATGCTGGG + Intergenic
1115508385 14:34114926-34114948 ATTTTCAGCCTGAAAGTGGCAGG - Intronic
1116691732 14:48115998-48116020 ATTTTCAGGCTTAATTTGGGTGG - Intergenic
1117248134 14:53907602-53907624 ACTTTCAGGCAGAGTTTAGAAGG + Intergenic
1117608394 14:57455890-57455912 ATTTTTAGGGAAAATGTTGAAGG + Intergenic
1119207120 14:72802719-72802741 ATTTTCAGATACAAAGTGGATGG + Intronic
1121102297 14:91258280-91258302 AGTTTCAGGCAGAAAGAGGCTGG + Intergenic
1123485780 15:20737000-20737022 ATTTTTAGGCAAAATGTTAATGG - Intergenic
1123542267 15:21306043-21306065 ATTTTTAGGCAAAATGTTAATGG - Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125041270 15:35190072-35190094 AATTTCAGGGAGGATATGGAAGG + Intergenic
1126652345 15:50937562-50937584 AGTGTAAGGCAGAATGTGAAGGG + Intronic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1129057366 15:72830329-72830351 ATTTCCAAGCAAAATATGGAAGG - Intergenic
1130790121 15:87145567-87145589 CCTTTCAGGTAGGATGTGGAAGG - Intergenic
1132401424 15:101509330-101509352 ATTTTCAATAAGAATGTTGAAGG + Intronic
1202950584 15_KI270727v1_random:33184-33206 ATTTTTAGGCAAAATGTTAATGG - Intergenic
1133131825 16:3680813-3680835 ATCTTCATACAGAAGGTGGAAGG - Intronic
1133445245 16:5853919-5853941 ATTTTAAGCCAGAATTTGGCTGG - Intergenic
1133849781 16:9491614-9491636 ATTTGCAAGGAGACTGTGGAGGG + Intergenic
1135340799 16:21646321-21646343 ATGTCCAGGCAGAATGGGAAGGG + Intronic
1136384657 16:29916029-29916051 CTTTCCAGACAGAATGTTGAAGG - Intronic
1137583347 16:49648277-49648299 ATTTCCAAGCAAACTGTGGAAGG + Intronic
1137840385 16:51635977-51635999 GTTCTCTGGCAGAATTTGGAAGG + Intergenic
1139271496 16:65687689-65687711 GTGATCAGGCAGACTGTGGATGG - Intergenic
1140063478 16:71590683-71590705 GTTTCCAGGCAGAATAGGGAAGG - Intergenic
1143161297 17:4873177-4873199 ATATCTAGGGAGAATGTGGATGG - Intronic
1145285576 17:21503791-21503813 ATTTCCAGGCAGACAGAGGATGG + Intergenic
1148038135 17:44684226-44684248 ATTTTAAGAGAGAATGAGGAAGG - Intronic
1149272792 17:54999673-54999695 ATTTTCTGGCTGAATGTTGTCGG - Exonic
1150178127 17:63083652-63083674 ATTATCAGGCAGACTGGGGAAGG - Intronic
1151632922 17:75323316-75323338 ATGTTAAGACAAAATGTGGAAGG + Intronic
1152433585 17:80262163-80262185 TGTTTCAGGTAGAGTGTGGAGGG + Intronic
1153782660 18:8507767-8507789 TTTTTCAGGAAGAATGTGTTAGG - Intergenic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155175691 18:23299379-23299401 ATCTTCAGGCAGAAGTTGGGTGG - Intronic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155708326 18:28844268-28844290 ATTTTCAAGCATCATGTAGAAGG - Intergenic
1156202084 18:34844923-34844945 CATTTCGGGTAGAATGTGGAGGG + Intronic
1158763040 18:60413586-60413608 ATTTTGAGGTAAAATGTTGAGGG - Intergenic
1158784555 18:60693850-60693872 ATTTTAATGTACAATGTGGATGG + Intergenic
1163289297 19:16368972-16368994 TTTTTCTGGCAGGATGGGGAGGG - Intronic
1163468738 19:17484881-17484903 ATTTTGATGCAGAAGCTGGAGGG + Intronic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1164894392 19:31859145-31859167 ATCTTCAGCCAGGCTGTGGAAGG - Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167084520 19:47300170-47300192 CTTTTGAGGCAGGATGTGGTGGG - Intronic
1167803650 19:51763604-51763626 ATTTGCAGCCAGATTTTGGAAGG - Intronic
925576695 2:5367516-5367538 AGCTTCAGGAGGAATGTGGAGGG + Intergenic
925614957 2:5736005-5736027 ATTTTCATGAAGAAAGTGGAGGG - Intergenic
925684485 2:6457703-6457725 TTTTTTAGGCAGTATGAGGATGG - Intergenic
927346570 2:22050804-22050826 ATTTTCAGGCATTCTGTTGAGGG - Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929849281 2:45568682-45568704 ATTTTCAAGCAGAAATTAGAAGG + Intronic
931424360 2:62157470-62157492 CTTTTCAGGCAGAATGAGTGAGG - Intergenic
933512982 2:83264414-83264436 ATTTTCTCCCAGAATGTTGAAGG - Intergenic
935560032 2:104550103-104550125 ATTTCCAGGCAAAATATTGAAGG - Intergenic
935673515 2:105575297-105575319 ATTTTGAGGCAGAATGTGCATGG + Intergenic
936405985 2:112203250-112203272 ATTCTCAGCCAGAATATTGAAGG + Intergenic
937510351 2:122588346-122588368 ATTTCTAGGCAAAATGTTGAAGG + Intergenic
939677524 2:145090882-145090904 ATTTTCAAGCAAAGTGTTGAAGG + Intergenic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
941297846 2:163762434-163762456 AATTCCAGGCAAAATGTGAAGGG + Intergenic
941465793 2:165825285-165825307 ATTTTCCCTCAGAATGTTGAAGG + Intergenic
942608353 2:177715199-177715221 ATTTTCACTCAGAATTTTGAAGG + Intronic
942884842 2:180910595-180910617 ATATTCAAGCAGAAGGTAGAGGG + Intergenic
942960591 2:181825646-181825668 TGTTTCAGGCACAGTGTGGAGGG + Intergenic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
945284262 2:208066317-208066339 ATGTCCAAGCAGAATGTAGAAGG + Intergenic
945706952 2:213247541-213247563 ATTTTCAGGCAGAAAGTGTTGGG + Intergenic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947328444 2:229002903-229002925 ATTTCCAAGCAGAGTGTTGAAGG - Intronic
947622473 2:231599504-231599526 TTTTTCAGGCAGAAAGGGAAAGG - Intergenic
1169076608 20:2763739-2763761 AATTTCAGGTGGATTGTGGATGG + Intergenic
1169826353 20:9772812-9772834 ATAGTCAGGCAGAATGTTCAGGG + Intronic
1170447086 20:16439453-16439475 ATTGTCAGGTAGAAAGTGAAGGG - Intronic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1172839032 20:37890992-37891014 ATCTACTGGCAGAATCTGGATGG - Intergenic
1173462787 20:43257327-43257349 ATTTTCAGGCAGAAAGAAGGAGG - Intergenic
1174284707 20:49464528-49464550 CTTTTCAGGCAGGGAGTGGAGGG - Intronic
1176114684 20:63426609-63426631 ATTTCCAAGCAAAGTGTGGAAGG - Intronic
1176978020 21:15346248-15346270 ATTTTCAGGAACAAAATGGAAGG - Intergenic
1177203155 21:17980141-17980163 TTTCTCAGGCAAAATGTAGATGG - Intronic
1177603454 21:23346340-23346362 ATTTTCAGGCAGCATATAGCTGG - Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1184026023 22:41857165-41857187 AAATTAAGGCAGAGTGTGGACGG + Intronic
949233169 3:1775293-1775315 ATTTCCAAGCAAAATGTTGAAGG - Intergenic
949434568 3:4014473-4014495 TTTTTCAAACAGAATGTGGTTGG + Intronic
950030498 3:9849334-9849356 ATATTCAGTCAAAATATGGACGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953058536 3:39407226-39407248 ATTTTCAAGCAGATTGTAGGCGG - Intronic
953216188 3:40921160-40921182 ATTATCAGGCAGAAAGGAGAAGG + Intergenic
953276493 3:41505278-41505300 ATTTTCAGGGAGGGTCTGGAAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
955621072 3:60864543-60864565 AGATTCAGGAAGAAGGTGGATGG + Intronic
957240914 3:77660277-77660299 ATTTCCAAGCAGAGTGTTGAAGG - Intergenic
958610815 3:96423887-96423909 ATTTCCAGGCAGAGTGTAAAAGG + Intergenic
960977842 3:123193726-123193748 CTTATCAGGCAGACTGTGGCAGG - Intronic
961554033 3:127685437-127685459 AGTTCCAGGCAGAATTTGGTTGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963392007 3:144676700-144676722 ATTTGCATGCAGAATCTAGAGGG + Intergenic
964102784 3:153006883-153006905 GTTTTCTGGGGGAATGTGGATGG - Intergenic
964268748 3:154931644-154931666 ATTTTCATGCATACAGTGGAAGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
966307360 3:178551517-178551539 ATTTTCAGAGAGGATTTGGAGGG + Intronic
966376237 3:179298461-179298483 ATTCTCAGCAAGAATGTGCAAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
967364180 3:188667144-188667166 AGTCTCAGGCACAAGGTGGAAGG + Intronic
971035827 4:22691881-22691903 ATTTTCACTCAGAATTTTGAAGG - Intergenic
971062764 4:22991147-22991169 ATTGTCAGGAAGAAAGTGGCAGG - Intergenic
971930106 4:33070401-33070423 ATTTTCAAGCAAAGTGTGGAAGG + Intergenic
972031037 4:34458505-34458527 ATTTTCAGCCAGAATATTGAAGG + Intergenic
972357415 4:38293354-38293376 ATTTCCAGGCAGAGTATTGAAGG + Intergenic
973188890 4:47364538-47364560 AATTTCAGGCTGAAAATGGAAGG + Intronic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
974278434 4:59758823-59758845 ATGTTCAGGAAGAATGAGGTAGG + Intergenic
974500870 4:62700597-62700619 ATTTTTAGGGAGAATGTTTAGGG + Intergenic
975419283 4:74143435-74143457 ATTTTCACGCTGAGTTTGGAAGG + Intronic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
980002019 4:127500720-127500742 ATTTCCAGGTGGAATGTTGAAGG - Intergenic
980103425 4:128564473-128564495 CTTTGCAGGGAGAATGGGGAGGG + Intergenic
980272068 4:130597318-130597340 ATTTCCAGGCAAAATGTTGAAGG + Intergenic
980802286 4:137767753-137767775 ATTATCAGGCAGTAGCTGGATGG + Intergenic
981714724 4:147741542-147741564 ATTTTCAGGCAGGGACTGGATGG + Intronic
981815421 4:148825603-148825625 ATTTTTAGACAGAATGTTGCAGG + Intergenic
981849809 4:149217092-149217114 ATTTTCAGGCAAAGTGTTAAAGG + Intergenic
982837888 4:160145697-160145719 ATTTTCAGGCAGACTATTAAAGG + Intergenic
983003031 4:162443510-162443532 AGTATCAAGGAGAATGTGGATGG - Intergenic
983968718 4:173845116-173845138 ATTTCCAGGCAGAATGTTGAGGG + Intergenic
984231045 4:177099387-177099409 ATTTTTAGCAAGAATGTGGAAGG + Intergenic
987879955 5:23730599-23730621 ATTTTCAGGCAAAGTGTCGAAGG - Intergenic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989170347 5:38466832-38466854 AGTGTCAGGGAGCATGTGGAAGG - Intergenic
989649993 5:43677227-43677249 ATTTTCAAGGAGAATGTGAGGGG + Intronic
991283509 5:64942635-64942657 ATTTTCTGTCAGAATGTGCTTGG + Intronic
992479105 5:77132925-77132947 AATTTCACTCAGAATTTGGAAGG + Intergenic
992964966 5:81990395-81990417 ATTACCTGGCAGAATGTGGGAGG + Intronic
993494540 5:88593106-88593128 ATAATGAGGCAGAAAGTGGAAGG + Intergenic
993803974 5:92381077-92381099 ATCTCCAAGCAGAATATGGAAGG - Intergenic
994055398 5:95408539-95408561 ATTTGGAGGCAGAGTTTGGAGGG + Intronic
994149250 5:96429757-96429779 TTCTTCATGAAGAATGTGGATGG - Intronic
994560665 5:101366982-101367004 GTTTTCAGGCAGATGGGGGAGGG - Intergenic
996063043 5:119052853-119052875 ATTTTCAGTGAAAATGTAGAAGG + Intronic
998658663 5:144210548-144210570 CTTTTCAAGCATTATGTGGAAGG + Intronic
998822479 5:146069140-146069162 ATCTTCAGGCAGAATATCTACGG - Intronic
999009978 5:148025508-148025530 ATTCTCAGGTGGAATGTGGGTGG - Intergenic
999176809 5:149637642-149637664 ACATTCAGGCAGAATATGCAAGG - Intergenic
999408496 5:151328299-151328321 AGTAGCAGGCAGAATGGGGAAGG + Intronic
1000027385 5:157371269-157371291 ATTTTCTGGCAGGAGGGGGACGG - Intronic
1001234729 5:170019954-170019976 ATTTTAAGGCAGGATATGGTAGG - Intronic
1001621553 5:173090004-173090026 TTTTTCAGGCAGAATGTTTATGG + Intronic
1001912914 5:175535847-175535869 ATTTTCATCCAGAATGTAGGAGG + Intergenic
1002958234 6:1889460-1889482 CTGTCCAGGGAGAATGTGGAGGG - Intronic
1003276739 6:4660437-4660459 ATTTTATGTCAGAATATGGAGGG - Intergenic
1003294739 6:4815188-4815210 ATATTCAGGCATATTCTGGAAGG - Intronic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1006795945 6:36732403-36732425 AATTTTAGGGAGAATGTGGGGGG + Exonic
1008837606 6:55855261-55855283 ATTTTGGGGGAGAGTGTGGAAGG + Intronic
1009050097 6:58264720-58264742 ATATTAAGGCAGAAAGAGGATGG - Intergenic
1010534637 6:77011931-77011953 ATGTTCAGGAAGAATGAGGTAGG - Intergenic
1011145708 6:84213867-84213889 ATATTCAGCAAGAATGTGCAGGG - Intronic
1014591406 6:123276420-123276442 ATTTTCAAGCAAAGTATGGAAGG + Intronic
1016318945 6:142821144-142821166 ATATTCAGGCAATATGGGGAAGG - Intronic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1018223771 6:161607959-161607981 ATTTTCTTTCAGAATGTTGAAGG - Intronic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019103169 6:169648519-169648541 AATATCAGGCAGAACGTGGCAGG + Intronic
1020009502 7:4800441-4800463 CTGTTCAGGCAGAATGTGACCGG + Intronic
1021402997 7:20231435-20231457 ATTTTCCTGCAAACTGTGGAGGG + Intergenic
1021971269 7:25967946-25967968 GTTTTCATGCAGATTGTGAATGG - Intergenic
1022371006 7:29771305-29771327 TTTTTCTGGCATATTGTGGAAGG - Intergenic
1022797169 7:33741507-33741529 ATTTTAAGACAAAATGTGAATGG + Intergenic
1022805675 7:33819863-33819885 ATTTCCAAGCAAAGTGTGGAAGG - Intergenic
1024415637 7:49102800-49102822 ATTCTCAAGCAGAAAGTAGAGGG - Intergenic
1024535504 7:50427740-50427762 ATTTTCAAGCAAAGTGTTGAAGG - Intergenic
1025269930 7:57500865-57500887 ATTTTCAGCCAGAATATTGAAGG - Intergenic
1028195016 7:87895994-87896016 ATAAGCAGGCAGATTGTGGAAGG - Intronic
1028473220 7:91226828-91226850 ATTTCTAGGCAGAATGTTGAAGG - Intergenic
1028738717 7:94248112-94248134 AGTTTCAGGAAGAATATGGAAGG + Intergenic
1029344410 7:99967943-99967965 AATTTCAGGCAGAATGGGCCAGG - Intronic
1029347038 7:99986214-99986236 AATTTCAGGCAGAATGGGCCAGG + Intergenic
1029882886 7:103835499-103835521 ATTCTGAGGCAGGATGTTGACGG + Intronic
1030419174 7:109286390-109286412 ATTTTCAAGCAAAGTGTTGAAGG - Intergenic
1030498976 7:110335278-110335300 ATTTTCAAGCAAAGTGTTGAAGG - Intergenic
1031276263 7:119727479-119727501 TTTTTCAGGCAGAATGAAAATGG + Intergenic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1032749414 7:134823056-134823078 ATTTTAAGGGGGCATGTGGAGGG - Intronic
1033889790 7:145997479-145997501 ATTTTGAGCTAGAATGTGGTAGG + Intergenic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1038046574 8:23770422-23770444 ATTTTCCCTCAGAATGTTGAAGG - Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1040707276 8:50144474-50144496 ATTTTCAGGAAGAATTTCCATGG + Intronic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041523692 8:58782464-58782486 ATTTTAAGCCAGAATGTGAATGG + Intergenic
1042021321 8:64373299-64373321 AATTTCAAGCAGAAAGTAGAAGG + Intergenic
1042030386 8:64469741-64469763 ATTTACAGGAAGAATGTGTCAGG - Intergenic
1043914169 8:85901220-85901242 ATCATCAGGAAGAATGGGGAAGG - Intergenic
1045080992 8:98625694-98625716 AATTTCAGGCAGAATGGAAAGGG + Intronic
1046053459 8:109051509-109051531 ATGTTTAGGCAGAATTTTGAAGG - Intergenic
1047164124 8:122417840-122417862 ATTTTCAGGCAGACTATTCAAGG - Intergenic
1047164586 8:122422886-122422908 ACGTTCAGACAGAATGTGGAGGG - Intergenic
1047428439 8:124767812-124767834 ATTTTCAGGTAAACTGAGGAAGG + Intergenic
1048385111 8:133904898-133904920 GGTTTCAGGCAGGATGTAGATGG - Intergenic
1048914973 8:139173857-139173879 AATGTCAGGCAGAATGTTAAAGG - Intergenic
1049691519 8:143962778-143962800 ATTTCCAAGCAAAGTGTGGAAGG + Intronic
1050073998 9:1845134-1845156 ATTTTAAGGCACCATTTGGAAGG - Intergenic
1050078396 9:1889030-1889052 ATTCTCAGGCACCATGTGGTTGG - Intergenic
1050131203 9:2414581-2414603 AGATTCAGGCAGACTCTGGATGG - Intergenic
1050536154 9:6632727-6632749 GCTTGCAGGCAGAATGTGGGTGG + Intronic
1052018191 9:23494045-23494067 ATAGTCAGGCAGGATGTAGAGGG - Intergenic
1052053323 9:23874538-23874560 CATATCAGGCAGAATGTGAATGG - Intergenic
1052132991 9:24873031-24873053 ATTTTCACCCAGAATGTACAAGG + Intergenic
1052353366 9:27480104-27480126 ATTTTCAGGGGAAATGAGGAAGG + Intronic
1052567860 9:30181699-30181721 ATTTTCAGGCAAATTGTGGAAGG - Intergenic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053463034 9:38285256-38285278 ATTTGCAGGCAAAAAGTGGCAGG + Intergenic
1055005928 9:71506399-71506421 ATTTTCTGGCAAAATGTGCAAGG - Intergenic
1055252219 9:74321395-74321417 AATCTGAGACAGAATGTGGAGGG + Intergenic
1056197669 9:84244209-84244231 ATTTTCACTTAGAATTTGGAAGG + Intergenic
1056945399 9:90991138-90991160 ATTTCCAGGCAAAGTGTTGAAGG - Intergenic
1057308468 9:93926276-93926298 ATCTTCAAGTAGAGTGTGGAAGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058944520 9:109843654-109843676 ATTTCCAGGGAGAAAGAGGATGG - Intronic
1059132883 9:111772995-111773017 GTTGTCAGGCAGAATGGGCAGGG + Intronic
1059724964 9:116998714-116998736 ACTTTCTGGCAGACTGTAGAGGG - Intronic
1060446275 9:123691131-123691153 ATTTTCAGGCCAAATCTGCAAGG + Intronic
1060553826 9:124498450-124498472 ATTTTCACGCAGGATGGGAAGGG - Intronic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186556614 X:10566844-10566866 ATTTTCTGGCAGAAAGGGGTTGG + Intronic
1187203629 X:17160155-17160177 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
1188321276 X:28740301-28740323 ATTTTAAGTGAGAATGAGGAAGG + Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189600362 X:42617517-42617539 AATGGCAGGCAGATTGTGGAGGG - Intergenic
1192482636 X:71498773-71498795 ACTTTCAGGCATAATGAGAAAGG + Intronic
1193668483 X:84353792-84353814 ATTTTCATGCAAAAAGAGGATGG - Intronic
1194275758 X:91879080-91879102 AGTTTCAGGCTGAATTTGGAAGG - Exonic
1194544274 X:95213253-95213275 ATTTCATGGCAGAATGTGGAAGG - Intergenic
1194755385 X:97733075-97733097 ATTTTCAGGCAGAATGTTGAGGG + Intergenic
1196127233 X:112113360-112113382 ACTTTCAGGCATAATGAGAAAGG + Intergenic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196549838 X:117010701-117010723 AGTTCCAGGCAGAATGTGTATGG + Intergenic
1196739427 X:119011420-119011442 TTTTTCAGGCTGCATGGGGAAGG - Intronic
1197969379 X:132099125-132099147 ATCTTCAGGCAGACAGTGAATGG + Intronic
1199730323 X:150625704-150625726 AGCTTCATGCAGAATGTGAAAGG - Intronic
1200593002 Y:5100514-5100536 AGTTTCAGGCTGAATTTGGAAGG - Exonic
1200813111 Y:7504800-7504822 GTTATCAGGAATAATGTGGAAGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1201625850 Y:16013358-16013380 ATATTCAGCTAGAATTTGGATGG + Intergenic
1202192497 Y:22259466-22259488 ACTTTCAGGCATAATGAGAAAGG + Intergenic