ID: 904834646

View in Genome Browser
Species Human (GRCh38)
Location 1:33327419-33327441
Sequence GAGGGTATTCTGCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904834640_904834646 4 Left 904834640 1:33327392-33327414 CCAAACTGTCGGGGATTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG 0: 1
1: 0
2: 3
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904834646 Original CRISPR GAGGGTATTCTGCATGAGGA AGG Intronic
900853540 1:5162715-5162737 TAGGGTATTCTGACTCAGGAGGG - Intergenic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
905416788 1:37809074-37809096 CAGGGTATTCTGCTCGGGGATGG - Exonic
907008901 1:50944325-50944347 GAGTGTTTTCTTTATGAGGAAGG + Intronic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908488362 1:64617753-64617775 GAGGATATTCTGCTTCAGAAAGG - Intronic
914829763 1:151162035-151162057 GAGGGTTTTCTTCAGGAAGATGG + Exonic
918150245 1:181792024-181792046 GAGGGTGTTCTTGATGAGGCAGG + Intronic
918198571 1:182245758-182245780 GAGGGTATTGTGCATTTGAAAGG - Intergenic
920600483 1:207320026-207320048 GAGGCTATTCTCTATGAAGAAGG + Intergenic
922604238 1:226879347-226879369 GAGGGTACTCTGAGTGAAGAGGG + Intronic
922850852 1:228732690-228732712 GATGATATTCAGCATGAGAAGGG + Intergenic
923070652 1:230561652-230561674 GAGGGTATGCTGCGAGCGGAGGG + Intergenic
924604920 1:245525137-245525159 GAGAGTCTTCTGCATGAAGCTGG - Intronic
1063537080 10:6893886-6893908 GAGGGTAGTCAGCAAGAGAATGG - Intergenic
1064742318 10:18446230-18446252 GATGGCAGTCTGCATGAGAAAGG + Intronic
1065877130 10:30007219-30007241 GTGGGTCTTCTCGATGAGGAAGG - Intergenic
1066563489 10:36694856-36694878 GAGTGTATTCTGCAACAAGAAGG + Intergenic
1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG + Intergenic
1067344560 10:45428099-45428121 GAGGGGATTCTGCACGGGCAGGG - Intronic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1071122046 10:82289301-82289323 GAAGGGATTTTGCCTGAGGAGGG - Intronic
1071998207 10:91167624-91167646 GAGAGAATGCTGCATGGGGAGGG + Intronic
1072044257 10:91638967-91638989 GAGGGAATTCTGCAAAAGGATGG + Intergenic
1073602671 10:104862012-104862034 GAGGGCATACTGCAGTAGGATGG - Intronic
1073991570 10:109267710-109267732 GTGGGTTTTATGTATGAGGAAGG - Intergenic
1074074028 10:110103925-110103947 GAGTGTATTTTGCATGTGGAAGG - Intronic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1081071449 11:38615315-38615337 GAGGGGTTTCTCCATGATGATGG - Intergenic
1082950078 11:58805326-58805348 GAGGTAAAACTGCATGAGGAGGG - Intergenic
1084764561 11:71299753-71299775 GAGGTTATTCTGCATGGGAGCGG + Intergenic
1084864460 11:72044438-72044460 GAGGGTATTCTGCCTGGAGCAGG + Intronic
1086253720 11:84848760-84848782 AAGGATATTTTGCATGTGGAAGG + Intronic
1088979994 11:114853841-114853863 GAGGTCATACTGCATGAGGGTGG + Intergenic
1089863031 11:121607011-121607033 CTGGGTATTCTGTATGACGAGGG + Intronic
1091690166 12:2590493-2590515 GCAGGTATTATGGATGAGGAGGG - Intronic
1092398095 12:8146259-8146281 GACGGAGTTCTGCAGGAGGAGGG + Intronic
1093462831 12:19421772-19421794 GAAGCTATTTAGCATGAGGAGGG + Intronic
1094374058 12:29771663-29771685 GGAGGTATTCTACCTGAGGATGG + Intronic
1094838496 12:34333313-34333335 GAGGGACTTTTGCCTGAGGACGG - Intergenic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1099208654 12:79758362-79758384 TGGGCTATTCTGCATGAGGTTGG + Intergenic
1100772255 12:97936288-97936310 GAGGGTATATTGCATCAGGCGGG + Intergenic
1102218566 12:111179129-111179151 GAGGGGATCCTCAATGAGGAGGG - Intronic
1103024526 12:117562844-117562866 TGGGGTTTTCTGCATGAGCAAGG - Intronic
1104933425 12:132352323-132352345 GAGGGCGTTCTGGATGAGGGGGG - Intergenic
1112584586 13:100707065-100707087 GAGGCTATACTGGATGAGGGCGG - Intergenic
1114640389 14:24215789-24215811 GAGTGTAATCTGCGAGAGGAAGG + Exonic
1115038395 14:28889038-28889060 GAGGTTATGCTGCTTGAGGAGGG - Intergenic
1116023198 14:39485930-39485952 GAGAACATTCTGCATGAAGAAGG - Intergenic
1117106784 14:52405541-52405563 GGGGGTCTTCTGCAGCAGGATGG - Intergenic
1118126247 14:62907908-62907930 GAGGGCATTGTGCAAGATGAAGG + Intronic
1118709499 14:68508089-68508111 GAGGGGAGTCTCCATGATGAGGG + Intronic
1120497304 14:85253238-85253260 TGGGGTATACTGCAGGAGGAAGG - Intergenic
1122825528 14:104368751-104368773 GAGGGGGTCCTGCATGTGGAGGG + Intergenic
1122849215 14:104517791-104517813 GAGCATAGTCTGCATGGGGAGGG - Intronic
1130177652 15:81591628-81591650 GAGGGGATTCTGCCTGCAGATGG - Intergenic
1130735478 15:86544033-86544055 GAGTGTATTTTGTATGTGGAAGG + Intronic
1131412714 15:92223951-92223973 TAGTGTATTTTGCATGTGGAAGG - Intergenic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1133721866 16:8502186-8502208 GAGTGTATTTTGCAAGTGGAAGG + Intergenic
1138234132 16:55366122-55366144 GAGGTTATTCTGTATCAGAAAGG - Intergenic
1138549737 16:57740827-57740849 GAGGGTGGGCTTCATGAGGAGGG - Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1143126622 17:4645481-4645503 GAGTGTATTTTGCATGTGGAAGG + Intergenic
1143234535 17:5387861-5387883 GAAGGCATTCTTCAGGAGGAGGG + Exonic
1143526827 17:7478006-7478028 GAGGGGATTTGGTATGAGGAAGG - Intronic
1145071314 17:19810911-19810933 GAGAGTGTTATGCAGGAGGATGG - Intronic
1147792222 17:43021117-43021139 GGGGGTCCTCTGCAGGAGGAAGG + Intronic
1148451523 17:47781167-47781189 GAGGGTCTTCTGCTTGAGGAGGG - Intergenic
1149442652 17:56687976-56687998 GAGTGTATTTTGCATGTGGGGGG + Intergenic
1150510005 17:65741144-65741166 TATGGTAATCTTCATGAGGAAGG - Intronic
1151130089 17:71887911-71887933 GAGGCTTTCATGCATGAGGATGG - Intergenic
1151335573 17:73437814-73437836 GAGGCGGTTCTGCAGGAGGAAGG + Exonic
1151448346 17:74181854-74181876 GAGGGAAGCCTGCAGGAGGAGGG - Intergenic
1153458013 18:5299559-5299581 GAGGAATTGCTGCATGAGGATGG + Intergenic
1153710905 18:7797883-7797905 GAGGGGATTCTGCAGCTGGAAGG - Intronic
1155437789 18:25831255-25831277 GAGTGTATTTTGCACGTGGAGGG + Intergenic
1155755507 18:29490045-29490067 GAGTGTATTTTGCATGTGGAAGG - Intergenic
1155916021 18:31557781-31557803 GAGGAGATTCTGCAGGAAGAGGG + Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1159020068 18:63136051-63136073 GAGGAAATTCTTCAGGAGGAAGG - Intronic
1160218372 18:76953949-76953971 CAGGTTATTCTGCATGGGGGTGG - Intronic
1161010384 19:1956998-1957020 GAGGGGATTCTGCAGAGGGAAGG + Intronic
1161683850 19:5693600-5693622 GGGGGCGTGCTGCATGAGGAAGG + Exonic
1163676094 19:18656033-18656055 GGGGGTGTTCTAGATGAGGAAGG - Intronic
1165920162 19:39292234-39292256 GAGTCTATTTTGCATGTGGAAGG - Intergenic
1168419519 19:56192165-56192187 GAGCTGATTCTGCATCAGGAAGG - Intronic
1168461496 19:56562738-56562760 GAGTGTATTCTGCATCTGGAAGG - Intergenic
1168666394 19:58208237-58208259 GAAGGTATCCTGCAGGGGGATGG + Intronic
925278671 2:2668434-2668456 GCTGGTCTTCTGCATGAGGGAGG - Intergenic
927640321 2:24841659-24841681 AAGAGGATGCTGCATGAGGAAGG + Exonic
927902167 2:26828397-26828419 GGGCAGATTCTGCATGAGGAAGG - Intergenic
929077939 2:38093797-38093819 AAGGATATTCTGCAAGGGGAGGG - Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
931667247 2:64618208-64618230 GGGGGCATACTGCAGGAGGATGG + Intergenic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
936803616 2:116297333-116297355 GAGGGAATTTAGCAAGAGGAAGG + Intergenic
942121183 2:172779334-172779356 GAGGGTAGACTTCATTAGGAAGG + Intronic
943284887 2:185985114-185985136 GAGTTTATTCTGCATGTGGTAGG - Intergenic
944879074 2:203992963-203992985 GAGGGTGTTATGCAAGAAGAAGG - Intergenic
946137656 2:217661040-217661062 GATGTTCTTCTGCAGGAGGAAGG - Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1169051903 20:2586068-2586090 GAGTGTATTCTGCATGTGGAAGG - Intronic
1177707499 21:24726385-24726407 GAGTGTAATCTTCATGAGGGTGG - Intergenic
1179958388 21:44753964-44753986 AAAGGTCTTCAGCATGAGGAGGG - Intergenic
1180595367 22:16969644-16969666 AAGGGTATTCCGCCTGGGGATGG + Intronic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
949378895 3:3422369-3422391 GAGTGTATTTTGCAAGTGGAAGG - Intergenic
953668277 3:44941633-44941655 TAGGTTCTTCTGCATGAGGAGGG - Intronic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
955853862 3:63251793-63251815 GAGGGTATAGGGCATGAGTATGG - Intronic
956278295 3:67527648-67527670 GGGGGTATATTGCATTAGGAAGG - Intronic
957814311 3:85273287-85273309 GTGGTTATTCTGGATGAGGTGGG + Intronic
957943172 3:87030897-87030919 GAAGGTCTTCAGGATGAGGATGG + Intergenic
959225316 3:103574568-103574590 GAGGGTTCTCTCCATGAGTAAGG + Intergenic
960168349 3:114429551-114429573 GAGGGTATTGAGGTTGAGGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961336591 3:126183914-126183936 GAATGTATTTTGCATGTGGAAGG + Intronic
963596203 3:147328308-147328330 GAGGGTATTTTGGAAGAGGTGGG - Intergenic
964519676 3:157551143-157551165 GAGGGTATTGAGCAAGAGCATGG - Intronic
964967923 3:162521251-162521273 GTGTGTATTCTGCAGGAGGAAGG - Intergenic
965253470 3:166371856-166371878 GAGGAAATAATGCATGAGGAGGG + Intergenic
967148511 3:186626900-186626922 GAGGGGATCCTGCCTGAGGATGG - Intergenic
968839409 4:2991210-2991232 GAAGAAATTCTGCCTGAGGACGG - Intronic
969556194 4:7912082-7912104 AAGGGTATTATGCATGATGGTGG + Intronic
969605621 4:8200932-8200954 GAGGGTGTTCCAGATGAGGATGG - Intronic
969757059 4:9156918-9156940 GAGGGAATTGTGCAGCAGGAGGG - Intergenic
969817018 4:9694493-9694515 GAGGGAATTGTGCAGCAGGAGGG - Intergenic
970942478 4:21651193-21651215 GAGGATATTCTACAAGAGCATGG + Intronic
971333386 4:25700947-25700969 GAGTGTATTTTGCATGTGGGAGG - Intergenic
976168091 4:82276187-82276209 GAGGGTATGTTCCCTGAGGAGGG - Intergenic
976794000 4:88912178-88912200 GAGGGTGTTCTGGAAGAGGCTGG + Intronic
976840813 4:89430551-89430573 GAGGGTATTCTGGAAGTGGGAGG + Intergenic
976964433 4:91018714-91018736 GAGGGGGTTCAGCATGAGAAAGG - Intronic
980330942 4:131410388-131410410 GACGCTATTCTGCATGAGTGTGG + Intergenic
984976586 4:185235880-185235902 GCAGGTATTCTGCATGAGTGTGG + Intronic
992349151 5:75911455-75911477 GAGGGTATGTTCCCTGAGGAGGG - Intergenic
992355956 5:75983642-75983664 GAGTGTATTTTGCATGTAGAAGG + Intergenic
998094762 5:139390951-139390973 GAGGGGGGTCTGCATGAGGTGGG - Exonic
999120142 5:149203207-149203229 GATGGTATTGTTCATGATGATGG - Intronic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003351455 6:5321386-5321408 GTGGGGCTTCTGCATGAAGAGGG + Intronic
1004318786 6:14615868-14615890 CAGAGTATTCTACATGAGGCAGG + Intergenic
1008460601 6:51765358-51765380 AAGGGTTTTATGCAGGAGGATGG - Intronic
1013163550 6:107569395-107569417 GAGGGCATAGTGCATGTGGAAGG + Intronic
1014884179 6:126759497-126759519 CAGTGTCTTCTACATGAGGAAGG - Intergenic
1018000325 6:159572914-159572936 GAGGCCCTTCTGCTTGAGGAAGG - Intergenic
1021988180 7:26117412-26117434 GAGGGCATTTTGCTTGAAGAGGG + Intergenic
1023384269 7:39639807-39639829 GAGGGCATCCTGCAACAGGACGG - Intronic
1023732539 7:43205967-43205989 GAGGGTGTCCTGGATGGGGAGGG - Intronic
1023957777 7:44901370-44901392 GAGGGAATTCTGCCTCAAGAAGG - Intergenic
1023999780 7:45182756-45182778 TAGGGTATCCTGGATGATGAAGG + Intronic
1027641407 7:80737800-80737822 GAAGGAATTCAGCTTGAGGAAGG + Intergenic
1029605626 7:101598000-101598022 GGTGGTAGGCTGCATGAGGAAGG - Intergenic
1031845450 7:126800293-126800315 GAGCGTAGACTGCATTAGGAAGG - Intronic
1032135620 7:129274429-129274451 GAGTGTATTTTGCATGTGGGAGG + Intronic
1033272337 7:139943931-139943953 GAGGGTTTTCTGAATAAGTAAGG - Intronic
1035456310 7:159011214-159011236 GAGGGCATTCTGGGTGTGGAGGG + Intergenic
1043529633 8:81135203-81135225 GAGGGTTTTCTGCAGGAGAGTGG - Intergenic
1048550879 8:135432823-135432845 CAGGGTATCCTGGATGAGGCAGG + Intergenic
1049127370 8:140804145-140804167 GAGGTTATTCTGTATTGGGAAGG - Intronic
1050220491 9:3383777-3383799 CAGAGTGTTCTGCATGGGGATGG + Intronic
1052549228 9:29926728-29926750 GAGTTTATTTTGCATGTGGAAGG - Intergenic
1052590493 9:30487426-30487448 GAGGTTATTTTGCATGGGGAAGG + Intergenic
1056534616 9:87516823-87516845 GAGGATATTGTGCAAAAGGAAGG + Intronic
1056893053 9:90514038-90514060 TTGGGTTTTCTGCATCAGGAGGG - Intergenic
1057890024 9:98862990-98863012 GAGGAATTTCTGCATTAGGAAGG - Intergenic
1057909422 9:99006056-99006078 GAGGGTATGAGGCATGATGAGGG - Intronic
1058118509 9:101112583-101112605 GTGGGGGTTCTGCATGTGGAGGG - Intronic
1059298103 9:113290506-113290528 GAGGAGATCCTGCATCAGGAAGG + Exonic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1061965028 9:134008626-134008648 GGGTGTATTCTGCATGTGCAAGG - Intergenic
1062261755 9:135666400-135666422 GAGATCATTCTGCATGAAGATGG - Intronic
1185482860 X:460572-460594 AAGAGAATTCTGCATTAGGAAGG + Intergenic
1185831346 X:3305722-3305744 GAGATTATTCTGGATAAGGATGG - Intergenic
1191102943 X:56752556-56752578 GAGGGGATGCTCCAAGAGGAAGG + Intergenic
1191204602 X:57820846-57820868 GAGGGGGTTCTGAATGAGGGGGG + Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1196304702 X:114087437-114087459 GAGGCTCCTCTGCATGTGGAAGG + Intergenic
1197685749 X:129437862-129437884 AAGGGTATTCTGTAAGAGAAGGG + Intergenic
1198605334 X:138331296-138331318 GAGGGAATTCTCTTTGAGGATGG - Intergenic
1200238878 X:154483333-154483355 CTGGGGATTCTGCATGAAGATGG - Intergenic
1201245218 Y:11996943-11996965 GAGATTATTCTGGATAAGGATGG + Intergenic