ID: 904834947

View in Genome Browser
Species Human (GRCh38)
Location 1:33329776-33329798
Sequence CACGGAAATGGGGTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904834947_904834962 15 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834962 1:33329814-33329836 GATGGAGGCAAACTGGAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 432
904834947_904834965 28 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834965 1:33329827-33329849 TGGAAGGTGGGGTGATGTTGAGG 0: 1
1: 0
2: 2
3: 56
4: 503
904834947_904834964 17 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834964 1:33329816-33329838 TGGAGGCAAACTGGAAGGTGGGG 0: 1
1: 0
2: 2
3: 34
4: 325
904834947_904834961 12 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834961 1:33329811-33329833 AAGGATGGAGGCAAACTGGAAGG 0: 1
1: 0
2: 0
3: 42
4: 410
904834947_904834963 16 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834963 1:33329815-33329837 ATGGAGGCAAACTGGAAGGTGGG 0: 1
1: 0
2: 2
3: 21
4: 251
904834947_904834952 -7 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834952 1:33329792-33329814 TTCCGTGGCCCCAGAAGCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 189
904834947_904834959 8 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834959 1:33329807-33329829 AGCCAAGGATGGAGGCAAACTGG 0: 1
1: 0
2: 2
3: 28
4: 315
904834947_904834954 -3 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834954 1:33329796-33329818 GTGGCCCCAGAAGCCAAGGATGG 0: 1
1: 0
2: 3
3: 32
4: 311
904834947_904834955 0 Left 904834947 1:33329776-33329798 CCAGGGGAGACCCCATTTCCGTG 0: 1
1: 0
2: 1
3: 17
4: 184
Right 904834955 1:33329799-33329821 GCCCCAGAAGCCAAGGATGGAGG 0: 1
1: 0
2: 2
3: 35
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904834947 Original CRISPR CACGGAAATGGGGTCTCCCC TGG (reversed) Intronic
900528499 1:3140988-3141010 CAGGGACATGGGGACTCCTCTGG - Intronic
900640359 1:3685456-3685478 CACGGAGATGGGGGATTCCCTGG + Intronic
901640063 1:10688619-10688641 GACGGAAATGAGGACTGCCCGGG - Intronic
901943391 1:12681431-12681453 CGTGGAGATGGGGTCTCCCTAGG + Intergenic
902251315 1:15155569-15155591 CAGGGAACTGGAGTCCCCCCAGG + Intronic
903372800 1:22847663-22847685 CACTGGAATAGGATCTCCCCTGG + Intronic
903428196 1:23270539-23270561 CAAGGAAATGGCCTCTCCCCTGG + Intergenic
904805355 1:33127507-33127529 CACGGGAAAGGGGTCAACCCGGG + Intergenic
904834947 1:33329776-33329798 CACGGAAATGGGGTCTCCCCTGG - Intronic
905213280 1:36389165-36389187 GAGGGAAAGGGGCTCTCCCCAGG - Intergenic
907932282 1:59011682-59011704 CAAGGAAATTGAGTCTCCCCAGG + Intergenic
908068073 1:60429213-60429235 CAAGGAAATGAGTTCTCCCCTGG + Intergenic
908254306 1:62290355-62290377 CCTGGAAATGGGGTCTTCCCTGG - Intronic
908804225 1:67913519-67913541 CAAGGAAATAGAGTCTCCTCTGG + Intergenic
911621244 1:100068152-100068174 CCAGGAAATGGGTGCTCCCCAGG - Exonic
911740512 1:101382234-101382256 CAAGGCAATGGATTCTCCCCTGG - Intergenic
915650632 1:157307818-157307840 CCAGGAAATGGGGTCTTTCCAGG - Intergenic
920778885 1:208968726-208968748 CAGAGAAATGGGGTCTCCCTGGG + Intergenic
923230066 1:231977366-231977388 CAAGCAAATGGATTCTCCCCTGG - Intronic
1064694995 10:17956155-17956177 CACGGACATGTGTGCTCCCCGGG + Intronic
1065069867 10:22012324-22012346 CAGGGAAATGTGGTCTCCGTGGG - Intergenic
1065125923 10:22574068-22574090 CTCGGAAATGGTGTCAACCCTGG - Intronic
1069981967 10:72258981-72259003 CACAGAAATGGCATCTCACCGGG + Intergenic
1070170564 10:73929690-73929712 CAGGGAAATGGATTCTTCCCTGG - Intergenic
1070672582 10:78388463-78388485 CTGGGAAATGGGATCTCCCTAGG + Intergenic
1071162827 10:82770861-82770883 AATGGAATTCGGGTCTCCCCTGG + Intronic
1073298512 10:102456167-102456189 CAAGAAAATGGATTCTCCCCTGG + Intergenic
1073570477 10:104576889-104576911 CACGGACATGGGGCCTGGCCAGG - Intergenic
1073615491 10:104990808-104990830 CAAGGAAATGGTTTTTCCCCTGG + Intronic
1074425119 10:113343827-113343849 TAAGAAAATGGAGTCTCCCCTGG + Intergenic
1074539521 10:114352971-114352993 TAAGGAAAGGGGGTTTCCCCAGG - Intronic
1075334251 10:121597507-121597529 CCCGAAAAAGGGGTCTCCGCAGG + Intronic
1075910355 10:126119380-126119402 CACTGACCTGGGGCCTCCCCTGG - Intronic
1076605014 10:131683652-131683674 CACGGAGATGGGGACACCGCAGG + Intergenic
1076631262 10:131853495-131853517 CAGGGTGACGGGGTCTCCCCAGG + Intergenic
1076631280 10:131853543-131853565 CAGGGTGACGGGGTCTCCCCAGG + Intergenic
1076998687 11:311397-311419 CGCGGAAATCGGGTCCCCCGCGG - Intronic
1077000056 11:318362-318384 CGCGGAAATCGGGTCCCCCGCGG + Intergenic
1077006331 11:359276-359298 CCTGGAAATGGGGTCTCTGCCGG + Intergenic
1077319365 11:1934310-1934332 CTTGGGAATGGGGTCTCCACAGG + Exonic
1085168155 11:74423450-74423472 CAAGGAAATGGATTCTCCCCTGG + Intergenic
1085789380 11:79484023-79484045 CAAGGAAATGGACTCTCCCCTGG - Intergenic
1086520397 11:87662249-87662271 CAGTGAAATGGGGTCTCCAGAGG + Intergenic
1088288086 11:108207711-108207733 CAGGGAAAGGGGGGCTTCCCTGG + Intronic
1090229749 11:125092937-125092959 CAAGGAAATGGGTTCTCTCGAGG + Intergenic
1091842650 12:3631824-3631846 AAAGAAAATGGAGTCTCCCCAGG + Intronic
1092712000 12:11348736-11348758 CAAGTAAATGGGTTCTGCCCTGG + Intergenic
1095133671 12:38572200-38572222 CAAGGAAATGGGCTCCCCTCTGG - Intergenic
1095548225 12:43397998-43398020 GAAGGAAATGGAGTTTCCCCTGG - Intronic
1096657876 12:53103039-53103061 CACGGAACTGGGGCCCCTCCAGG - Intergenic
1096699277 12:53371535-53371557 CACGGAACTGGGGCCACCCTGGG - Intergenic
1106389380 13:29320279-29320301 CAAGGAAACGGACTCTCCCCTGG + Intronic
1106421432 13:29589298-29589320 CCCTGCAAAGGGGTCTCCCCAGG + Intronic
1112318156 13:98383261-98383283 CACAGAAATGGGGGCACGCCTGG - Intronic
1113717680 13:112524697-112524719 CCTGGAAAGGGTGTCTCCCCTGG + Intronic
1114683707 14:24507908-24507930 GAAGGAAAAGGGGTATCCCCAGG - Intronic
1121102699 14:91261058-91261080 CAAGGAAATGGAGTCTCCCCTGG + Intergenic
1121649816 14:95549681-95549703 CAAGGAAACGGATTCTCCCCTGG + Intergenic
1121742672 14:96265069-96265091 CAAGGAAATGGCTTCTCCCCTGG + Intronic
1122871106 14:104639433-104639455 CAGGGAAGTGGGGTCTCCAGGGG - Intergenic
1123023779 14:105414284-105414306 AAGGGAAACAGGGTCTCCCCTGG - Intronic
1202870894 14_GL000225v1_random:162677-162699 CATGGAAACGGACTCTCCCCTGG - Intergenic
1124409772 15:29427510-29427532 CAAGGAAAGGGACTCTCCCCTGG - Intronic
1125719738 15:41839546-41839568 CCTGGAAATGGGCTCTCTCCTGG - Intronic
1126305070 15:47246511-47246533 CAAGGAAATGGATTCTCCCCTGG - Intronic
1128190127 15:65685217-65685239 CAGGGAAATGGCGTGACCCCGGG - Intronic
1129220311 15:74128490-74128512 CAAGGAAAGGGGGTCTTCCCTGG + Exonic
1129501087 15:76038365-76038387 CAGGGAAGTGGGGTCCCCTCTGG - Intronic
1130710022 15:86270904-86270926 AAAGGAAATGGAGTTTCCCCTGG - Intronic
1132118704 15:99158343-99158365 CTGGGAAAGGGAGTCTCCCCGGG - Intronic
1133734219 16:8601847-8601869 CAAGGAAATGATTTCTCCCCTGG - Intergenic
1136868338 16:33773981-33774003 CAAGGAAATAGGGTGTCTCCTGG + Intergenic
1137656499 16:50163860-50163882 TATAGAAATGGGGTCTCGCCGGG + Intronic
1137700416 16:50493939-50493961 CTAGGAAAGGGGGTCTGCCCAGG - Intergenic
1139345835 16:66303153-66303175 CAAGGAAATGGATTCTGCCCTGG + Intergenic
1141455576 16:84139473-84139495 CAAGGAAAAGGATTCTCCCCTGG + Intronic
1141459324 16:84168139-84168161 CAAGGAAGCGGGTTCTCCCCTGG - Intronic
1141525065 16:84605700-84605722 CAAGAAAATGGATTCTCCCCTGG + Intronic
1141702269 16:85647987-85648009 CAAGCACATGGGGGCTCCCCGGG + Intronic
1203103837 16_KI270728v1_random:1342295-1342317 CAAGGAAATAGGGTGTCTCCTGG - Intergenic
1203129677 16_KI270728v1_random:1620073-1620095 CAAGGAAATAGGGTGTCTCCTGG + Intergenic
1142630786 17:1224852-1224874 CTTAGAAATGGGGTCTCACCGGG + Intronic
1144951006 17:18993389-18993411 CACAGCAATGGAGTCTCCCAAGG + Intronic
1149184360 17:53979633-53979655 CAAGGAAATGGGCTCTCTTCTGG + Intergenic
1150460659 17:65347567-65347589 AAGGGAAGTGGGGTCTGCCCCGG - Intergenic
1152039746 17:77894970-77894992 TCCGGGAATGGGGTCTGCCCAGG + Intergenic
1152305266 17:79516687-79516709 CACAGACTTGGGGCCTCCCCAGG + Intergenic
1154001405 18:10485373-10485395 CCGGCAAATGGGGTCTCACCAGG - Intronic
1155963233 18:32013166-32013188 CATAGAAACGGGGTCTCGCCAGG - Intergenic
1157297451 18:46456649-46456671 GAAGGAAATGGGGTGTCCACTGG - Exonic
1159637921 18:70827851-70827873 CATGGAAATGGGGACACCCCAGG - Intergenic
1160956234 19:1693303-1693325 GCAGGAAATGGGTTCTCCCCTGG - Intergenic
1161226876 19:3150914-3150936 CCAGGAAATAGGGTCTCCCTGGG - Intronic
1161582612 19:5088967-5088989 CATAGAAATGGGGTCTCGCACGG - Intronic
1162048741 19:8019083-8019105 CAGGGAAATGGATTCTCCCTTGG + Intronic
1163859248 19:19732644-19732666 GACCGAGATGGGATCTCCCCAGG + Intronic
925024086 2:594420-594442 CACGGCAATGGCCTCGCCCCAGG + Intergenic
928749955 2:34459402-34459424 CACAGGAATGGGGTTTCCCAAGG + Intergenic
928807046 2:35171425-35171447 CAAGGAAGTGGATTCTCCCCTGG + Intergenic
929571899 2:43027940-43027962 CAAGGAAGTGGATTCTCCCCTGG - Intergenic
931319099 2:61158841-61158863 CACAGAAATGGACTCTCCCCTGG - Intronic
935503254 2:103868213-103868235 GAGGAAAATGGGTTCTCCCCTGG + Intergenic
935788508 2:106570327-106570349 CCAGGAAACGGGCTCTCCCCAGG + Intergenic
937452318 2:122011665-122011687 CAAGGAAATGGGACCTCCCATGG - Intergenic
938230148 2:129651339-129651361 CAAGGAAACAGGCTCTCCCCTGG + Intergenic
938705777 2:133924258-133924280 CAAGGAAATGGATTCTGCCCTGG + Intergenic
939649287 2:144741840-144741862 AAAGGAAATGGGGTTCCCCCTGG + Intergenic
946134631 2:217635705-217635727 CAAGAAAATGGATTCTCCCCTGG - Intronic
947110026 2:226708554-226708576 CAAGGAAATGGATTCTGCCCTGG + Intergenic
947130884 2:226923896-226923918 CAGGGAAGTGGGGTCCCCTCTGG + Intronic
948824030 2:240565819-240565841 CACAGAGATGGGGACTGCCCTGG - Intronic
1169220230 20:3818345-3818367 CAAGGAAAAGGGATCTCCCAGGG + Intergenic
1170893150 20:20392686-20392708 CATGGAAATTGGCTTTCCCCGGG - Intronic
1172108324 20:32529758-32529780 CACTGAAATGGGTTCTGACCAGG - Intronic
1172698741 20:36839755-36839777 CAAGGAAAAGGTTTCTCCCCTGG + Intronic
1174300758 20:49580400-49580422 GACCCAGATGGGGTCTCCCCAGG + Intergenic
1174632012 20:51966460-51966482 AACCGAAATGAGGTGTCCCCTGG - Intergenic
1174825960 20:53768763-53768785 GAGGGCAATGGGGTCTCCCAGGG - Intergenic
1176005935 20:62862137-62862159 CACGGACGTGGCTTCTCCCCAGG - Intergenic
1177890487 21:26798582-26798604 CAAGGAAATGGATTCTCCCTTGG - Intergenic
1181129932 22:20725204-20725226 CAGGGAAATGAGGTCAGCCCTGG + Intronic
1181695220 22:24589579-24589601 CACAGAAAATGGGTCTGCCCAGG + Intronic
1182566183 22:31201612-31201634 CAAGGAAATAGGGTCTTACCTGG - Exonic
1184337922 22:43865783-43865805 CAAGGAAATAGGTTCTCCCCTGG - Intergenic
1184716071 22:46282461-46282483 AAGGGAGATGGGGCCTCCCCTGG + Intronic
1184874034 22:47261416-47261438 CAAGGAAATGGGTTCTCTGCTGG - Intergenic
1185180922 22:49362653-49362675 CAAGGAAAGGGATTCTCCCCCGG - Intergenic
1185251290 22:49802966-49802988 CATGGAACTTGGGGCTCCCCGGG - Intronic
950108502 3:10403604-10403626 CATGGAAATGGCCGCTCCCCAGG - Intronic
953212264 3:40886644-40886666 CACTGATATGGGGTCTGACCAGG - Intergenic
956959040 3:74376104-74376126 GAAGGAAATGGATTCTCCCCTGG + Intronic
958067720 3:88565656-88565678 CAAGGAAATGGATTCTCCCTTGG - Intergenic
966712058 3:182980819-182980841 AACGGAGGTGGGGTGTCCCCCGG - Intronic
969250003 4:5961062-5961084 CAAGGAACTGAGGGCTCCCCAGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969932189 4:10641456-10641478 AAGGGCAATGGGGTCTCCACTGG - Intronic
970695349 4:18670348-18670370 CAAGAAAATGAGATCTCCCCTGG + Intergenic
974079547 4:57197941-57197963 CACGGACATGCAGTCTCCCATGG - Intergenic
974301044 4:60067513-60067535 CAGGGAAATGGGCTCCCCTCTGG - Intergenic
975503874 4:75117135-75117157 CAAGGAAATGGGTTCTCTTCTGG - Intergenic
977015111 4:91682744-91682766 CATGGAAATAGAATCTCCCCTGG - Intergenic
979794078 4:124822931-124822953 CAGAGAAATAGGGTCTCCCTGGG + Intergenic
981666429 4:147232057-147232079 CACTGAAATGGGGACTCTTCCGG + Intergenic
986261857 5:6154652-6154674 CGCTGAAATGGGGTCTTGCCAGG - Intergenic
989146982 5:38258689-38258711 CACGGAAAGGGCGTCTCCGGGGG - Exonic
989610593 5:43287013-43287035 CAAGTAAATGGATTCTCCCCTGG - Intergenic
990577033 5:57133256-57133278 CATAGAGATGGGGTCTCCCTAGG + Intergenic
991122168 5:63029194-63029216 CAAGGAAATGGATTCTTCCCTGG + Intergenic
993049414 5:82909376-82909398 CAAGGAAATGGATTCTCTCCTGG + Intergenic
996063239 5:119054482-119054504 CATAGAGATGGGGTCTCACCAGG - Intronic
1002053995 5:176588137-176588159 CACGGAAATGAGGGATCCCAGGG + Intronic
1003749959 6:9043821-9043843 AAAGTAAATGGGGTCTCCCAAGG - Intergenic
1006300921 6:33193151-33193173 CAGGGAAATGGGGTCACTCGGGG + Intergenic
1006464401 6:34183215-34183237 CAAGGAAATGGGGACTGGCCAGG + Intergenic
1007391169 6:41550138-41550160 CAAGGAACTGAGGCCTCCCCAGG + Intronic
1015049707 6:128825161-128825183 CACCGAAATGTGGTTGCCCCAGG - Intergenic
1015578849 6:134701929-134701951 CAAGGAAATGGGTTCTCTTCTGG + Intergenic
1017078348 6:150640837-150640859 CAGAGAAATGGGGTCTCCTGTGG + Intronic
1017756103 6:157531060-157531082 CACGGAAGTGGGGTCTGCTCAGG + Intronic
1018754818 6:166839779-166839801 CCCAGAAATGGGTTCTCCCTTGG + Intronic
1019739812 7:2667044-2667066 CAAGGAAATGGACTCTCGCCTGG - Intergenic
1021629354 7:22629269-22629291 CAAGGAAATGGATTCTCCCCTGG + Intronic
1021877414 7:25061781-25061803 TGGGGAAAGGGGGTCTCCCCAGG - Intergenic
1030908378 7:115214563-115214585 CAAGCAAATGGGTTCTTCCCTGG - Intergenic
1032755751 7:134889244-134889266 CAAGGAAATGGATTCTCCCCTGG - Intronic
1033541959 7:142365530-142365552 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1034254184 7:149715273-149715295 CACGCCAAGGGGGTTTCCCCAGG - Exonic
1034941371 7:155232450-155232472 CAAGAAAACGGGGGCTCCCCTGG + Intergenic
1035844738 8:2850888-2850910 GCCGGAAATGGGGTTTCCACTGG - Intergenic
1038401015 8:27284538-27284560 GTTGGAAATGGGGTCTCTCCAGG + Intergenic
1038971731 8:32644265-32644287 CATGGAAATGGGGTGTTCCTGGG + Intronic
1041019833 8:53627415-53627437 CAAGGAACAGGGCTCTCCCCAGG + Intergenic
1041883317 8:62778599-62778621 CAGGGAAGTGGGCTCTCCTCTGG + Intronic
1044237840 8:89852429-89852451 CAAGGAAATAGGTTCTTCCCTGG - Intergenic
1047002417 8:120586410-120586432 CAAGGAAGAGGGTTCTCCCCAGG - Intronic
1047757681 8:127931255-127931277 AATGGAAAAGGGGTCTCCCTGGG - Intergenic
1048281667 8:133110117-133110139 CACTAAAGTGGGTTCTCCCCAGG - Intronic
1048324688 8:133429929-133429951 CAAGGAAATGGATTCTCCTCTGG - Intergenic
1050160532 9:2714374-2714396 CACTTAAGTGGGGTCTACCCAGG + Intergenic
1051047226 9:12889153-12889175 CAGGGAAGTGGGCTCTCCTCTGG - Intergenic
1051562037 9:18452940-18452962 CTTGGAAATGGGGCCACCCCTGG - Intergenic
1051889894 9:21930880-21930902 CCTGGAAATGGGATCTTCCCTGG + Intronic
1054742559 9:68822944-68822966 CAAGGAAGTGGACTCTCCCCTGG - Intronic
1055427040 9:76206947-76206969 CAAGAAAATGGATTCTCCCCTGG - Intronic
1057555150 9:96082270-96082292 CAAGGATGTGGGTTCTCCCCTGG - Intergenic
1059413003 9:114145415-114145437 CAAGCTAATGGGGTCTCCTCTGG - Intergenic
1061915568 9:133751410-133751432 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1062436250 9:136547762-136547784 CCTGGATAGGGGGTCTCCCCTGG + Intergenic
1203733560 Un_GL000216v2:113908-113930 CATGGAAACGGACTCTCCCCTGG + Intergenic
1185676757 X:1855690-1855712 CCAGGAAGTGGGTTCTCCCCAGG - Intergenic
1186274338 X:7923395-7923417 TAAGGAAATGGATTCTCCCCTGG + Intronic
1187118188 X:16375145-16375167 AAAGGAAATGGATTCTCCCCTGG - Intergenic
1189314584 X:40045635-40045657 TATAGAGATGGGGTCTCCCCAGG + Intergenic
1190121412 X:47662426-47662448 CAGGGAAATGCAGCCTCCCCTGG - Intergenic
1192505618 X:71680411-71680433 CATGGTAATGGGCTCTCCTCTGG + Intergenic
1194804605 X:98311888-98311910 CAAGGAAATGGATTCTTCCCTGG + Intergenic
1194937601 X:99970235-99970257 CAGGGTAATGGGCTCTCCTCTGG + Intergenic
1196552532 X:117045924-117045946 CAGGGAAATGGGCTCCCCACTGG - Intergenic
1197028312 X:121782496-121782518 CAGGGAAATGGGCTCCCCTCTGG + Intergenic
1197435626 X:126425044-126425066 CAGGGCAATGGGCTCTCCTCTGG + Intergenic
1198586038 X:138123640-138123662 CAGGGAAATGGGCTCCCCTCTGG + Intergenic
1199512251 X:148635369-148635391 CAAGGATATGGATTCTCCCCTGG + Intronic
1202627449 Y:56874510-56874532 CATGGAAACGGGCTCTCCCCTGG - Intergenic