ID: 904837705

View in Genome Browser
Species Human (GRCh38)
Location 1:33349763-33349785
Sequence CGGCGTCAACAAAGGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904837688_904837705 28 Left 904837688 1:33349712-33349734 CCGAGCCGGGGCCCGGGGCTGCC 0: 1
1: 0
2: 4
3: 55
4: 479
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837691_904837705 17 Left 904837691 1:33349723-33349745 CCCGGGGCTGCCGCGGCGCATCC 0: 1
1: 0
2: 1
3: 39
4: 177
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837693_904837705 7 Left 904837693 1:33349733-33349755 CCGCGGCGCATCCGACCGCACCG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837692_904837705 16 Left 904837692 1:33349724-33349746 CCGGGGCTGCCGCGGCGCATCCG 0: 1
1: 0
2: 3
3: 10
4: 164
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837698_904837705 -8 Left 904837698 1:33349748-33349770 CCGCACCGGCCTGGCCGGCGTCA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837697_904837705 -4 Left 904837697 1:33349744-33349766 CCGACCGCACCGGCCTGGCCGGC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46
904837690_904837705 23 Left 904837690 1:33349717-33349739 CCGGGGCCCGGGGCTGCCGCGGC 0: 1
1: 0
2: 7
3: 97
4: 672
Right 904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG 0: 1
1: 0
2: 1
3: 6
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904837705 Original CRISPR CGGCGTCAACAAAGGGCGGC CGG Intronic
904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG + Intronic
905429880 1:37914055-37914077 AGGAGTCAGCAAAGGGTGGCAGG - Intronic
912417683 1:109521271-109521293 TGTGGTCAATAAAGGGCGGCTGG - Intergenic
922734818 1:227973278-227973300 CGGGGTCAACAAATGCCGGCGGG + Intergenic
923517622 1:234710511-234710533 CGGCGTCAACAAGGGGCTGCAGG + Intergenic
924343395 1:243054557-243054579 CGGGGTCTACAAAGGCCGGCGGG - Intergenic
1062819564 10:523980-524002 TGGGGTCAGCAAAGGGTGGCTGG + Intronic
1066733077 10:38450957-38450979 CGGGGTCTACAAAGGCCGGCGGG + Intergenic
1073013610 10:100381187-100381209 AGGAGTCAACAAAGGGTGGTGGG - Intergenic
1077246650 11:1542509-1542531 CGGCGGCACCACAGGGAGGCAGG + Intergenic
1081008213 11:37774502-37774524 CGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1084876881 11:72139646-72139668 AGGCCTTCACAAAGGGCGGCTGG - Exonic
1089432616 11:118436457-118436479 AGGCGACAACACAGGGGGGCGGG - Intergenic
1089877781 11:121742267-121742289 TGGCGTCACCAAAGTGCTGCTGG - Intergenic
1095581617 12:43806412-43806434 CGGCGGCCAGGAAGGGCGGCGGG - Intergenic
1097281293 12:57846602-57846624 CGGCCTGTACAAAGGGCGGGCGG + Exonic
1102472315 12:113166216-113166238 AGGGGTCAACAAACTGCGGCCGG + Intronic
1105270975 13:18875250-18875272 CGGGGCCAACAGCGGGCGGCGGG - Intergenic
1122814318 14:104304836-104304858 CCGCCTCACCAAAGGGCTGCAGG - Intergenic
1123004568 14:105315048-105315070 CGGCGGGAACAAAGCGCGGCGGG - Exonic
1136683713 16:31982208-31982230 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1136784342 16:32925764-32925786 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1136885443 16:33928042-33928064 CGGCGGCCACAGAGGGCGGGCGG - Intergenic
1203086999 16_KI270728v1_random:1189770-1189792 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1142457027 17:62733-62755 CGGGGTCTACAAAGGCAGGCGGG - Intergenic
1145694508 17:26775672-26775694 CGGCGGCAAAAAGCGGCGGCTGG - Intergenic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1149575177 17:57706884-57706906 CTGCATCAACGAAGGTCGGCGGG - Intergenic
1159521578 18:69531869-69531891 GGGCTTCAACAAATGGCGGTGGG - Intronic
935775488 2:106467811-106467833 CGGCCTCAACAGAGCGCGCCAGG + Intronic
940945694 2:159615610-159615632 CGGAGGCAAAAAAGGGCAGCAGG + Intronic
947704516 2:232263401-232263423 CGCCGTCCACAAAGCGCTGCTGG - Exonic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1175077979 20:56392091-56392113 CGGCGGGGACAAGGGGCGGCTGG - Exonic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
959840581 3:110969623-110969645 CCGCGGCAACAACGGGTGGCAGG + Intergenic
978617917 4:110614332-110614354 CTCCGTCCACTAAGGGCGGCTGG + Intergenic
983229217 4:165112763-165112785 CGGCGTCGGGAAATGGCGGCGGG - Exonic
995474776 5:112536838-112536860 CAGAGTCTACAAAGGGCTGCAGG + Intergenic
1013369049 6:109454855-109454877 CTGCCTCAACAAACGGCGGGAGG + Intronic
1024074645 7:45812260-45812282 CGGGGTCTACAAACGCCGGCGGG + Intergenic
1024075128 7:45814188-45814210 CGGGGTCTACAAACGCCGGCGGG + Intergenic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1025052322 7:55741621-55741643 CGGGGTCTACAAACGCCGGCGGG - Intergenic
1025129994 7:56370151-56370173 CGGGGTCTACAAACGCCGGCGGG - Intergenic
1025878391 7:65509172-65509194 CGGCGGCAAAAAGCGGCGGCGGG + Intergenic
1032051644 7:128653910-128653932 CGGGGTCTACAAAGGCCGGCGGG + Intergenic
1038798181 8:30727652-30727674 CGGCGCCAGCAGCGGGCGGCGGG + Exonic
1190337427 X:49270604-49270626 CGCCCTCAGCAAAGGGCAGCTGG - Exonic
1200613997 Y:5356935-5356957 CGGCCTCACCAAAGAGGGGCTGG - Intronic
1202380930 Y:24276271-24276293 CGGGGTCTACAAAGGCCGGCAGG + Intergenic