ID: 904837841

View in Genome Browser
Species Human (GRCh38)
Location 1:33350213-33350235
Sequence ACTGAGCTCTCGGTGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904837841 Original CRISPR ACTGAGCTCTCGGTGACTGG TGG (reversed) Intronic
904117671 1:28174458-28174480 ACTGAGTTTTCTCTGACTGGTGG - Intronic
904320630 1:29695711-29695733 AATGAGCTCCCCGTCACTGGAGG + Intergenic
904379141 1:30099714-30099736 AATGAGCTCCCCGTCACTGGAGG - Intergenic
904432963 1:30477005-30477027 ACTGGCCTCTGGGTGACAGGTGG - Intergenic
904837841 1:33350213-33350235 ACTGAGCTCTCGGTGACTGGTGG - Intronic
905402086 1:37711103-37711125 ACTGAGCTCCAGCTGACTGTTGG - Intergenic
905892343 1:41525321-41525343 AGTGAGCACTTGGTGAATGGCGG - Intronic
907307655 1:53522335-53522357 ACTGAGCCCCCGGGGACTTGGGG - Intronic
907395489 1:54186790-54186812 GCTGAGGTCTCGGTGTCAGGGGG + Intronic
907571585 1:55488855-55488877 TCTGAGCTCCCCGTGAATGGAGG + Intergenic
908331010 1:63071141-63071163 TCTCAGCTCTCCGAGACTGGGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
912492751 1:110070856-110070878 ACTGGGCTCTGGGTGAATGGGGG - Intronic
912734805 1:112141295-112141317 AATGAGCTCCCTGTCACTGGAGG + Intergenic
913971587 1:143421577-143421599 ACTGAGCTCTCCCTGGCTAGGGG + Intergenic
914065964 1:144247190-144247212 ACTGAGCTCTCCCTGGCTAGGGG + Intergenic
914113187 1:144719164-144719186 ACTGAGCTCTCCCTGGCTAGGGG - Intergenic
915463615 1:156083147-156083169 TCTGAGATCTCCGAGACTGGGGG - Intronic
915534422 1:156526386-156526408 CCTGAGCTCTAGGTGTCTGCAGG + Exonic
917980509 1:180266253-180266275 GGTAAGCTCTGGGTGACTGGGGG + Intronic
919993102 1:202722735-202722757 AGTGATCTATCAGTGACTGGAGG + Intergenic
923862757 1:237908140-237908162 ACTGAGCTATGGATGACTGGAGG + Intergenic
1068936387 10:62639409-62639431 AATGAGCTCCCTGTCACTGGAGG + Intronic
1069599368 10:69693569-69693591 AGTGAGCTCCCTGTCACTGGAGG + Intergenic
1069743332 10:70699472-70699494 AGGGAGCTCTCTGTCACTGGAGG + Intronic
1069907601 10:71740903-71740925 AAGGGGCTCTCGATGACTGGAGG - Intronic
1073273681 10:102289342-102289364 ATTCAGCTCTTGGTGACAGGAGG + Intronic
1073444104 10:103570759-103570781 ACTGGGCTCTGGGTGACTTCTGG + Intronic
1074226863 10:111493476-111493498 CCTGAGGTCTCGGTGGCTGTGGG - Intergenic
1075657711 10:124173146-124173168 CCTGAGCTCTGGGTGACCTGGGG + Intergenic
1077308287 11:1877450-1877472 ACTGAGCTCTCCCTGGCTAGGGG - Intronic
1077886285 11:6390394-6390416 GCTGATCTCTCGGTGGCGGGCGG - Intergenic
1079382833 11:19953584-19953606 ACTGAGCTAACTGTGACTGGGGG - Intronic
1083722372 11:64609695-64609717 GCTCAGCTCTAGGTGGCTGGTGG + Intronic
1083727545 11:64636383-64636405 ACTGAGCTCTCTGGGGGTGGGGG + Intronic
1084149212 11:67280374-67280396 AGTGAGCTCTGTGTCACTGGGGG + Intronic
1089396257 11:118137871-118137893 CCTGAGCTCTCCGTGACTAGAGG + Intronic
1089629574 11:119775828-119775850 ACTGAGCTCTCCATTACTGGAGG + Intergenic
1090631904 11:128656915-128656937 ACTGAGCTCTCAGTGGCTGTAGG + Intergenic
1091028562 11:132163064-132163086 ACTGGGCTCCAGGTGGCTGGTGG - Intronic
1091236873 11:134028023-134028045 CCAGAGCTCTCTGTGCCTGGTGG + Intergenic
1092917958 12:13205085-13205107 AGTGAGCTCTCCATGACTGGAGG + Intronic
1093593932 12:20939754-20939776 ACTGGGCTCTCTGATACTGGGGG + Intergenic
1095243634 12:39891314-39891336 ACTGAACTCTCAGCAACTGGAGG + Intronic
1101098958 12:101372571-101372593 GCTGATCTCTCTGTGACAGGTGG - Intronic
1101830216 12:108251134-108251156 CCTGAGCTCTCCGTGCTTGGGGG - Intergenic
1102257595 12:111425200-111425222 AGAGAGCACTCTGTGACTGGGGG + Intronic
1103519944 12:121531555-121531577 AGTGAGCTCCCTGTCACTGGAGG - Intronic
1110122064 13:71894785-71894807 AATGTGCTCTTGGTGACTCGGGG - Intergenic
1113290403 13:108899705-108899727 CCTGAGCTCTCAGTGACTGGTGG + Intronic
1119995374 14:79247999-79248021 AGTGAGCTTTCTTTGACTGGTGG + Intronic
1122219127 14:100224362-100224384 ACTGAGCTCTGGGTGCCCAGTGG + Intergenic
1130022616 15:80243753-80243775 ACTCATCTCACTGTGACTGGTGG - Intergenic
1130650812 15:85761134-85761156 ACTGCGCTGCCGGTGAATGGTGG - Intronic
1131221355 15:90587246-90587268 ACTGAGCTCTAGGTCCCTTGGGG + Intronic
1131255256 15:90857806-90857828 ACTGAGCTCCCCGTCTCTGGAGG - Intergenic
1131668074 15:94591159-94591181 TCTGAGCTCTGGGCGACTGAGGG + Intergenic
1132463171 16:65569-65591 TCTGAGGTCTCAGTGACAGGAGG + Intronic
1136511053 16:30738531-30738553 ATTGAGCTGGGGGTGACTGGTGG + Exonic
1139198244 16:64946337-64946359 ACTGAGCACTGGGGAACTGGGGG - Exonic
1140760384 16:78103814-78103836 ACTGAGACCTCGGGGTCTGGTGG + Intronic
1142120631 16:88384881-88384903 AGTGAGTTCCCGGTCACTGGAGG - Intergenic
1143355720 17:6326509-6326531 ACTGAGGCCTGGGTGAATGGTGG + Intergenic
1145752662 17:27366539-27366561 CATGAGCTCTCTGTGACTCGAGG + Intergenic
1147166049 17:38594006-38594028 ACTGAGCTCCCCATCACTGGGGG + Intronic
1148590227 17:48810941-48810963 ACTGAGCTCTGGTTGATTGCTGG - Intronic
1148784059 17:50136713-50136735 ACTGAGCTGTGGGGGACTGGAGG - Intronic
1148867860 17:50638412-50638434 AGTGAGCTCCCTGTCACTGGGGG + Intronic
1151952978 17:77365511-77365533 ACTGAGCTCCCTGTAACTGGAGG + Intronic
1162320844 19:9969980-9970002 AGTGGGGTCTGGGTGACTGGGGG + Intronic
1162320863 19:9970049-9970071 AATGAGGTCTGGGTGAGTGGGGG + Intronic
1164710332 19:30352659-30352681 AGTAAGCTCTCGGTGAGTGGTGG + Intronic
1166811188 19:45515495-45515517 ACTGAGCTCTCGGCGTGTGCTGG + Intronic
1167288846 19:48613769-48613791 ACTGGGCACTGTGTGACTGGTGG - Intronic
1168309507 19:55453256-55453278 ACTGAGGTCCGGGTGACAGGAGG + Exonic
1168588953 19:57616919-57616941 ACAGAGCTTTGGGTGACTGCAGG - Intronic
925406844 2:3611403-3611425 ACTGTGCAATCGGTGAATGGAGG - Intronic
929484752 2:42343222-42343244 TGGGAGCTCTCTGTGACTGGCGG - Intronic
930020847 2:47001336-47001358 CCTGAGCTCTAGCTGCCTGGGGG - Intronic
931908137 2:66865052-66865074 AGTGAGCTCCCGGTCACTGGAGG + Intergenic
932810677 2:74823157-74823179 ACTGAGCTCCCACTGTCTGGAGG + Intergenic
933112088 2:78415762-78415784 AGTCATCTCTCGGTGTCTGGTGG + Intergenic
934176283 2:89582510-89582532 ACTGAGCTCTCCCTGGCTAGGGG + Intergenic
934286593 2:91656871-91656893 ACTGAGCTCTCCCTGGCTAGGGG + Intergenic
942044887 2:172094610-172094632 ACTGTGCTGTCGGTGCCAGGCGG + Intergenic
946432504 2:219633105-219633127 AATGAGCTCTCTGTCACTTGTGG - Intronic
948931219 2:241133579-241133601 CCTGCGCTCACGGGGACTGGAGG - Intronic
1168745548 20:236698-236720 TCTGAGCTCTGGGTAAATGGAGG + Intergenic
1170605940 20:17875187-17875209 ACTGAGCACTGGGGGCCTGGTGG + Intergenic
1172150399 20:32786457-32786479 ACTGGGCCTTAGGTGACTGGAGG - Intronic
1172770778 20:37381430-37381452 AGTGAGCTCCCTGTCACTGGAGG - Intronic
1173737598 20:45373006-45373028 ACAGAGCTCTCCGGGATTGGGGG - Exonic
1173961588 20:47076837-47076859 ATTGAGCTCTGGGTAGCTGGTGG - Intronic
1174139468 20:48403047-48403069 AGTGAGCTCACTGTCACTGGTGG - Intergenic
1175801648 20:61804448-61804470 GCTGACCTCCAGGTGACTGGTGG - Intronic
1179179003 21:39029448-39029470 CCTGGGCTCTCAGTGATTGGAGG + Intergenic
1183200930 22:36385774-36385796 ACTGCGCTCTGGATGACTGTGGG - Intronic
1183345943 22:37307935-37307957 AATGAGCTCTTTGTCACTGGAGG - Intronic
1184040611 22:41940995-41941017 GCTGAGCTCTGGGAGCCTGGTGG - Intronic
1184274080 22:43400285-43400307 ACTGAGCTCCCAGAGGCTGGTGG + Intergenic
950180605 3:10910527-10910549 AGTGAGCTTCCGGTCACTGGTGG + Intronic
950665622 3:14493237-14493259 AGTGAGTTCTCGGTCACAGGAGG - Exonic
961663379 3:128482019-128482041 ACTGAGCTGGTGGGGACTGGGGG - Intronic
961782260 3:129327176-129327198 ACTCAGCTCACGGTGACTCCAGG - Intergenic
967293050 3:187940431-187940453 AGTGAGCTCTTGGCCACTGGAGG - Intergenic
969102249 4:4777919-4777941 AGTGAGCTCCCCGTCACTGGAGG + Intergenic
969709641 4:8835338-8835360 AGTGAGCTCTCCGTCCCTGGAGG - Intergenic
975672673 4:76797679-76797701 ACCGAGTTCTAGGGGACTGGAGG - Intergenic
978473735 4:109101300-109101322 GCTGAGCCCTCGGTGACTGCAGG + Intronic
978901398 4:113954129-113954151 ACTGAGATGTCGGTGACTTGAGG - Intronic
982722101 4:158869632-158869654 ACTGAGCTCACTGGGACAGGTGG + Intronic
985176816 4:187211129-187211151 ACTGAGTTCTATGTGACTGGTGG + Intergenic
985897148 5:2755416-2755438 TATGAGCTTTCGGTGTCTGGCGG + Intergenic
990671185 5:58131894-58131916 ACAGTGCTCTCTGTGAGTGGTGG - Intergenic
992893933 5:81231146-81231168 AGTGAGTTCTCTGTGCCTGGAGG - Intergenic
993889181 5:93452436-93452458 CCTGAGCTCACTGTGACTGCTGG - Intergenic
996512163 5:124328821-124328843 ATTGAGGATTCGGTGACTGGGGG - Intergenic
999421660 5:151449745-151449767 ACGGAGCTCCCTGTCACTGGAGG + Intronic
1000251026 5:159495771-159495793 ACTCAGCTCTCAGTGACTTTTGG - Intergenic
1003124902 6:3348386-3348408 CCTGAGCTTTGGGTGACTTGTGG + Intronic
1003525540 6:6893764-6893786 AGTGAGCATTCGGTGACTGCAGG - Intergenic
1006171907 6:32097915-32097937 ACTGGGGGCTCGGTGCCTGGGGG + Intronic
1017604224 6:156116330-156116352 ACTGAGCTTGCTGTCACTGGAGG - Intergenic
1017870411 6:158481963-158481985 ACTGAGCTGGCAGTGACTGATGG - Intronic
1018129193 6:160712201-160712223 ACTGAGGTCTCGGGGGGTGGGGG + Intronic
1019550628 7:1600622-1600644 AGTGAGCTCTCTGTCACTGGAGG - Intergenic
1019556627 7:1634709-1634731 CCTGAGCTCTCAGTGACAGCTGG - Intergenic
1020977114 7:15020436-15020458 ACTGAGCTCCAGGTGACTTGAGG - Intergenic
1022533010 7:31078821-31078843 ACAGTGCTGTCGGTGACTTGTGG + Intronic
1023017490 7:35982437-35982459 TCTGAGCTCGAGGTCACTGGGGG + Intergenic
1024574233 7:50751055-50751077 AGTGAGCTCTCGGTCCCTGTGGG - Intronic
1024640016 7:51320778-51320800 ACTCAGCTCTCCATGACTCGAGG + Intergenic
1025062353 7:55821314-55821336 ACTGAGCTCTCAGTTACCAGTGG + Intronic
1029205706 7:98868326-98868348 CTTGAGCTCTGGGTGACTTGGGG - Intronic
1029614987 7:101650638-101650660 AGTGAGCTCCCCGTCACTGGAGG + Intergenic
1032586643 7:133153024-133153046 AAGGAGCTCACGGTGGCTGGAGG - Intergenic
1035742665 8:1939799-1939821 GCTCAGCTCCCGGGGACTGGGGG + Intronic
1047226528 8:122959874-122959896 ACTGTGCTTTGGGTGACTTGTGG + Intronic
1050745657 9:8873129-8873151 ACTGAGCTGTCGGCTCCTGGAGG + Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1058445523 9:105051521-105051543 ACTGAACTCTTGCTGTCTGGCGG + Intergenic
1059417582 9:114171380-114171402 ACTCAGATCTGGGGGACTGGGGG + Intronic
1059827424 9:118046743-118046765 ATTGAGCTCTCAGTCACTAGAGG - Intergenic
1061348111 9:130042941-130042963 ACCGAGCTCTGGGTGAGTGAGGG - Exonic
1188786613 X:34354170-34354192 ACCGTGCTCTTTGTGACTGGAGG + Intergenic
1189306732 X:39992401-39992423 ACTGAGCCCTCTGTCACTGAAGG + Intergenic
1189459780 X:41230566-41230588 ACTGAGATCCAGGTGAATGGGGG - Exonic
1199289275 X:146088472-146088494 TCTGAGCTCTCAGTGAGTTGTGG + Intergenic