ID: 904838657

View in Genome Browser
Species Human (GRCh38)
Location 1:33356011-33356033
Sequence TTTAGGTTCTTAAAGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904838657 Original CRISPR TTTAGGTTCTTAAAGTATCC AGG Intronic
900665673 1:3813980-3814002 TTATGGTTATTAATGTATCCAGG + Exonic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905366789 1:37456328-37456350 TTCATTTTCTTAAAGTATGCTGG + Intergenic
905728309 1:40274713-40274735 TTTGTGTTTTTAAAATATCCTGG + Intronic
905958580 1:42022812-42022834 TGTAAGTACTTAAAGTATCTTGG + Intronic
906946884 1:50301943-50301965 AGTAAGTTCTAAAAGTATCCCGG - Intergenic
910030624 1:82717775-82717797 TTTAGGTCCTTAAAGAGGCCTGG + Intergenic
911017961 1:93355164-93355186 TTTATGTATTTAAAGTATCCAGG - Intronic
911162562 1:94696243-94696265 TTTAAGTTCTTTATGTATTCTGG - Intergenic
911258991 1:95664532-95664554 TTTAGGTTGTTTCTGTATCCTGG - Intergenic
911289156 1:96035205-96035227 TTTGAGTTCTTATAGAATCCTGG - Intergenic
912497467 1:110100783-110100805 TTCAGGATCTTAAAGCATCAAGG - Intergenic
919427605 1:197452144-197452166 TTTAGACTCTACAAGTATCCCGG + Intronic
920613059 1:207461023-207461045 TTTAGTTTCTTATGCTATCCTGG + Intronic
923277341 1:232408745-232408767 TTTACGTACTTTAGGTATCCTGG + Intronic
1063649072 10:7915341-7915363 TTTAGGCTCCTAAAGAATCATGG + Intronic
1064385789 10:14890020-14890042 TTTGGTTTCTTAAAGTATACAGG + Intronic
1066471211 10:35700096-35700118 TTTAGGTTGATAAATTTTCCAGG + Intergenic
1066579587 10:36865582-36865604 TTTAGTTTCCAAAAGTATCATGG - Intergenic
1068183432 10:53552658-53552680 TTTAAGATCTTAAATTTTCCTGG - Intergenic
1068327049 10:55505396-55505418 ATTATTTTCTTAAAGAATCCAGG - Intronic
1074008694 10:109455604-109455626 GTTAGGATGTTAAAGTTTCCAGG + Intergenic
1075517953 10:123124364-123124386 TTTAGGTTGTTAACGTATCTTGG + Intergenic
1079435371 11:20442086-20442108 TTTAAGTTCTGAAACTAGCCGGG - Intronic
1084691452 11:70729430-70729452 TTTGGGATCTAAAAGTATTCTGG + Intronic
1086090740 11:83002315-83002337 TTCAGGTCCTGAAAGAATCCTGG - Intronic
1087561654 11:99797405-99797427 TTTGGCTTCTTAAAGTTTGCTGG - Intronic
1088953923 11:114599088-114599110 CATAGGTTGTTAAAGTAGCCAGG + Intergenic
1092306104 12:7302847-7302869 TTTAGGTTCTTGATGTAGGCAGG - Intergenic
1093740952 12:22687504-22687526 TTTGGCTTGTTAAAGCATCCAGG - Exonic
1095088053 12:38079551-38079573 TGTAGGTTCTTAAAGATTCTGGG + Intergenic
1095889601 12:47223267-47223289 TTTTGGTTCTTACAGTATGAGGG - Intronic
1097429955 12:59493196-59493218 TTTAAGTTCATAAAATATGCTGG + Intergenic
1098626935 12:72683013-72683035 TTTACCTTTTTAAAGTACCCTGG - Intergenic
1100566397 12:95798293-95798315 TTTAGGATCGGAAAGTGTCCAGG - Intergenic
1101602307 12:106221361-106221383 TTCAGGTGCTTAAATTATTCAGG + Intergenic
1101668131 12:106839252-106839274 TTTAGGTTGTTTCAGTATCTTGG - Intronic
1108079077 13:46714582-46714604 CTTAGATTCTTAAAGTAGGCTGG + Intronic
1108231155 13:48343271-48343293 TTTATCTTCAGAAAGTATCCAGG + Intronic
1110334903 13:74316336-74316358 ATTTGGTACTTAAAGAATCCTGG - Intergenic
1110674989 13:78231608-78231630 TTTATGCTCTTAAATTTTCCTGG + Intergenic
1114976093 14:28101762-28101784 TTTAGGTTCTTAAATAAAACAGG + Intergenic
1115358997 14:32480603-32480625 TTTGGGTTCTAAAAATATTCTGG - Intronic
1117203188 14:53413283-53413305 GTTTGGTTCTTAATGTATCATGG + Intergenic
1118750998 14:68807828-68807850 TTTCGGGTCTTAAAGGATGCTGG + Intergenic
1120282704 14:82459302-82459324 TTAAACTTCTTAAAATATCCCGG - Intergenic
1121623893 14:95371032-95371054 TGCAGGTTCTTAAAGAAACCCGG - Intergenic
1121925292 14:97921736-97921758 TTTAGGTATTGAAAGCATCCTGG + Intergenic
1124991807 15:34681782-34681804 TTGAGGTTCAGAAAGTATGCTGG - Intergenic
1125401425 15:39308405-39308427 TTTATGTTCTTGAAGCATACTGG + Intergenic
1125824899 15:42667843-42667865 TATATGTTATTAAAGTATCCTGG + Intronic
1132926986 16:2435785-2435807 TTTATGTTCTTAATGTTTCAGGG + Exonic
1136122570 16:28148525-28148547 ATTAGTTTCTTAAAGAAACCTGG - Intronic
1137535810 16:49324240-49324262 TTTATGGTATTAAAGTGTCCCGG - Intergenic
1137842116 16:51650322-51650344 TTGAGGATCTGAAAGTAGCCCGG - Intergenic
1138314567 16:56058317-56058339 TTTAGGTCCTTAACATATCTGGG - Intergenic
1138363020 16:56449016-56449038 TTTAAATTTTTAAAGCATCCTGG - Intronic
1145780367 17:27559094-27559116 TTTGCGGTCTTAAAGTTTCCAGG + Intronic
1146928202 17:36759549-36759571 TTCAGGTACTTAAAGTACCTGGG + Intergenic
1153397542 18:4641523-4641545 TTTAGGTAGTTAAACCATCCGGG + Intergenic
1156141835 18:34121832-34121854 TTTTGGTTATTACAGTATCTGGG + Intronic
1157903867 18:51548076-51548098 TTTAGGTTCTTTATGTATTTTGG + Intergenic
1158230490 18:55249143-55249165 TTTAGATTCTAAAAGTACCCTGG - Intronic
1159533173 18:69681640-69681662 TTTAAATTCTTAAAATTTCCAGG + Intronic
1161730588 19:5958355-5958377 TTTAGCTTTTTAAAGTTTACAGG + Intronic
1165027542 19:32972576-32972598 TTTAAGTTTTAAAAGAATCCTGG - Intronic
1165875586 19:39004406-39004428 TTTTGGTTCTAAAATTAGCCGGG - Intronic
926647806 2:15308604-15308626 CTTAGGTGCTGAAAGGATCCTGG - Intronic
926808463 2:16735117-16735139 ATTAGTTTCTAAAAGTATCATGG + Intergenic
928248499 2:29653271-29653293 TTGTGGTTTTTAAACTATCCAGG - Intronic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
930214846 2:48684269-48684291 TTTAGGGCCTTAAAGGATGCAGG + Intronic
933221706 2:79697430-79697452 TTTAGCTCCTTATAGTTTCCTGG + Intronic
933357960 2:81237901-81237923 TTAAGTTTCTTATAGTATTCAGG + Intergenic
935082358 2:99810529-99810551 ATTAGGTTCTTAAATCCTCCAGG + Intronic
935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG + Intronic
936630807 2:114200786-114200808 TTTAGGTTTCTAAATTATTCTGG + Intergenic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
941078172 2:161030138-161030160 TTTAGGATATTAAAGTATGAAGG + Intergenic
941490870 2:166140842-166140864 TTAAAATTCTGAAAGTATCCTGG - Intergenic
941683606 2:168425702-168425724 TTATTCTTCTTAAAGTATCCAGG + Intergenic
943776184 2:191768750-191768772 TTTAGCTACTTAAAATATACTGG + Intergenic
944603841 2:201331443-201331465 CTTGGGTTCTAAAATTATCCTGG - Intronic
945953119 2:216059002-216059024 ATTAAATTTTTAAAGTATCCTGG + Intronic
947556529 2:231098308-231098330 TATAGGTTTTTAATTTATCCTGG + Intronic
947692970 2:232156664-232156686 TTTAGGTCCGTATTGTATCCTGG + Intronic
1176948126 21:15009008-15009030 TTTATATTCTTAAATTATCAAGG - Intronic
1177452300 21:21286130-21286152 TTTAAGATTTTAAAGTATCTAGG + Intronic
1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG + Intergenic
949223708 3:1667999-1668021 TTTAGGTTCTAAAAATATGTGGG + Intergenic
949659525 3:6261909-6261931 TTTATGTTCTTAGGGAATCCTGG + Intergenic
952351721 3:32545640-32545662 TTAAGCATCTTAAGGTATCCTGG - Intronic
953140454 3:40224733-40224755 TTTGGGTTCTTAAGTCATCCAGG - Intronic
955077384 3:55626359-55626381 TCTGGTTTCTTAAAGGATCCGGG - Intronic
955521140 3:59776653-59776675 TTTATGTTCTTAAATGATGCTGG - Intronic
956475707 3:69617874-69617896 TTTGGGTTCTGAAAATATTCAGG + Intergenic
957142339 3:76376888-76376910 TTTAGGTTCTGGTTGTATCCTGG + Intronic
957534921 3:81489447-81489469 TTTAGCTTCTAAAAGTGTTCAGG + Intergenic
957714760 3:83912281-83912303 GTTAATTTCTTAAAGTATTCTGG + Intergenic
959351229 3:105267132-105267154 TTTCTGTTCTTAAAATATTCAGG + Intergenic
960221110 3:115109751-115109773 TTTAAGTTCTGAAATTATCTAGG - Intronic
960591154 3:119367149-119367171 TTCAGGTTCTGAAAGTATCAGGG + Intronic
962770699 3:138608326-138608348 TTTAGGTCCTTAAAGGATGCAGG - Intergenic
962915997 3:139904272-139904294 TTTATGTTCTCACAGTCTCCAGG - Intergenic
964287330 3:155132713-155132735 TTTGGGTTTAAAAAGTATCCTGG + Intronic
965067941 3:163876338-163876360 TTTAGATTTTTAAAATATACTGG + Intergenic
966557789 3:181283324-181283346 TTTAGTTTGATAAAGTATCAAGG + Intergenic
967986995 3:195102723-195102745 TTTAGGTTCTTTCCGTATCTTGG + Intronic
968254279 3:197251786-197251808 TTTAAGCTCTTAATATATCCTGG - Intronic
971490001 4:27202068-27202090 TTTACGTTATTAAAATATTCTGG - Intergenic
974961993 4:68714069-68714091 TTTAGGATCTGAAAGTATACCGG - Intergenic
975474993 4:74813091-74813113 TTGAGCTACTTAAAGTTTCCTGG + Intergenic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
976040407 4:80877151-80877173 AGTAGATTCTAAAAGTATCCTGG - Intronic
978154716 4:105475472-105475494 TGTGGATACTTAAAGTATCCAGG + Intergenic
980615412 4:135215856-135215878 TTTAGATTAAAAAAGTATCCTGG + Intergenic
981166880 4:141570228-141570250 TTTAATTACTTAAAGTATCTTGG - Intergenic
981283605 4:142990307-142990329 TTTTTGTTCTTAAAGCAGCCAGG + Intergenic
985169876 4:187137536-187137558 TTTTGATTCTTAGAGTATTCTGG - Intergenic
985420163 4:189777303-189777325 ATTAGGCTCAAAAAGTATCCTGG + Intergenic
986616445 5:9622300-9622322 TTTGGATTCTAAAAGTATCTGGG + Intergenic
988262708 5:28909516-28909538 TTTAGAATTTTAAAGTATCATGG + Intergenic
988880040 5:35492223-35492245 TGTAGTTTCTTAGAGTATCTGGG + Intergenic
991777430 5:70098820-70098842 TTTAGGTTCTCTTAGTAACCTGG - Intergenic
991856718 5:70974264-70974286 TTTAGGTTCTCTTAGTAACCTGG - Exonic
991923610 5:71682212-71682234 GTAAGGTTCTTAAAGTATTAAGG - Intergenic
992163555 5:74026063-74026085 TTTAGCTGCTTGAAGTAACCAGG + Intergenic
993055397 5:82974605-82974627 TATAGGTTTTTAATTTATCCTGG + Intergenic
995030871 5:107479904-107479926 TTTAGTTTTTTAAAATATACTGG - Intronic
996253736 5:121371975-121371997 TTTATTTTCTTATAGTATTCAGG - Intergenic
996497603 5:124179251-124179273 TTTAAGTTCTTAAAGGCTCCAGG + Intergenic
996924005 5:128801032-128801054 TTTATGTTTTTATAGTATTCTGG - Intronic
998562442 5:143184039-143184061 TTTAGATTCTGAAAGTTTCATGG + Intronic
999739197 5:154536828-154536850 TTTAGGTTGTTCTAGTATCTTGG + Intergenic
1000030117 5:157394325-157394347 TTTATGTTCTTAAAATCTCAGGG - Intronic
1004125484 6:12868865-12868887 TTGAGGTTCTTATATTTTCCTGG - Intronic
1005499290 6:26416060-26416082 TATAGTTTCTTACAGTGTCCTGG - Intergenic
1006063554 6:31443439-31443461 TTGAGTTTCTTATAGTATTCTGG + Intergenic
1008334612 6:50286887-50286909 TTTAGGTTCAGAGAGTATACGGG - Intergenic
1008486219 6:52039005-52039027 TGTAAGTTCTTAAAGTATTTTGG - Intronic
1008677847 6:53840399-53840421 ATTAGATTCTAAAAGTTTCCAGG - Intronic
1008902355 6:56635297-56635319 TTTAAGTTCTTAATATATCCTGG - Intronic
1009032995 6:58082555-58082577 TTTATTTTCTTTAAGTATGCTGG - Intergenic
1009295997 6:61948466-61948488 TTTTGATTCTTAAATTATCAGGG - Intronic
1014657295 6:124123496-124123518 TTAAGGTTCATAAACTATCTAGG - Intronic
1015894599 6:138004756-138004778 TTTAGATTTTTAAAGTAATCTGG - Intergenic
1017080910 6:150667495-150667517 TTTAGGATCATAAGGTATCTTGG + Intronic
1017436047 6:154416772-154416794 TTTATATTCTGAAAATATCCTGG + Intronic
1017440414 6:154459793-154459815 TTTACTTTCTTAAATTATCCTGG - Intronic
1017779470 6:157705086-157705108 TTTATGTTCTTAAAGAACACAGG + Intronic
1018513118 6:164548292-164548314 TTTAAATTATTAAAGTATTCAGG + Intergenic
1018766967 6:166941868-166941890 TTTATGTTCTTAAAAAAGCCAGG + Intronic
1018778832 6:167044178-167044200 TTCAGGTTCCTAAAGTACCTTGG - Exonic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1022281238 7:28912017-28912039 TTTTGGTTTTAAAACTATCCTGG + Intergenic
1024478409 7:49838721-49838743 TTTAGGACCTAAAAGTTTCCAGG + Intronic
1024494793 7:50033346-50033368 TTTAGTTCCTTAAAGCAGCCTGG - Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1030139521 7:106290670-106290692 TTTTTGCTCTTAGAGTATCCAGG + Intergenic
1032935526 7:136726860-136726882 TTTAAGTTCTTAATCTATCCTGG - Intergenic
1032963137 7:137063759-137063781 CTTAGGTTCTTACAATATCTTGG - Intergenic
1037451922 8:19024299-19024321 TTTAGATTGTAAAAGTACCCTGG + Intronic
1037619822 8:20553876-20553898 CTTTGTTTCCTAAAGTATCCAGG + Intergenic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1039687666 8:39823095-39823117 TTTAGATTGTTTAAGCATCCTGG + Intronic
1043965479 8:86470075-86470097 TTTAGGTTCTTATAGAATCACGG + Intronic
1044043442 8:87399542-87399564 ATTAGGTTCATAAATTATCCAGG - Intronic
1046611868 8:116434723-116434745 TTTTGGTTCTGAAAGTATATTGG - Intergenic
1049077356 8:140409667-140409689 TTTTGGTTGCTAATGTATCCTGG - Intronic
1051388420 9:16537126-16537148 TTTAGGTTTTTCAACTACCCTGG + Intronic
1052618363 9:30872645-30872667 TTTAACTTATTTAAGTATCCAGG + Intergenic
1055539078 9:77282421-77282443 TTTATTTTCTAAAATTATCCTGG - Intronic
1057101297 9:92362917-92362939 TTTTGGTGCTCAAAGTGTCCCGG + Intronic
1059091338 9:111361836-111361858 TTTATGTTTTTAAAGTATCTGGG - Exonic
1059162056 9:112043752-112043774 TCTAGCTTCTTAAAGTGTCAAGG - Intronic
1186392352 X:9173669-9173691 TTTAGGTTCTTTAAAGATTCTGG - Intergenic
1186815233 X:13230396-13230418 GTTTGGTTTTTAAAATATCCAGG + Intergenic
1187780477 X:22816999-22817021 TTTAGGTTCTTAGAGTATATGGG + Intergenic
1188577293 X:31667014-31667036 TTCTGGTTCTTAATGTATTCAGG + Intronic
1188970287 X:36606945-36606967 TGTAGGTTCTTAATGTATAAAGG - Intergenic
1191967272 X:66773096-66773118 TTCAGGTTTTGAATGTATCCTGG + Intergenic
1196221836 X:113120354-113120376 TTTAGGTTCTTAAAATAGCTTGG - Intergenic
1197653906 X:129095181-129095203 TTTAGGTGCTTATATTACCCTGG - Intergenic