ID: 904842118

View in Genome Browser
Species Human (GRCh38)
Location 1:33379394-33379416
Sequence GGCAAGGGGGACAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 7, 3: 73, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904842118 Original CRISPR GGCAAGGGGGACAGTGGGCA GGG (reversed) Intronic
900114456 1:1022511-1022533 GCCAAGGGGGACAGGTTGCAGGG + Intronic
900399886 1:2468583-2468605 GTGAAGGGGGACAGTGGCCACGG + Intronic
900438172 1:2641162-2641184 GGGAAGGGGGGCTGTGGGGAGGG + Intronic
900464864 1:2820684-2820706 GGCCAGGGGGCCAGGGGGCCAGG + Intergenic
900648783 1:3720969-3720991 GGTGAGGGGCACAGAGGGCATGG + Intronic
901225862 1:7612658-7612680 GGCAGGGGTCACAGTGTGCATGG + Intronic
901366008 1:8748948-8748970 GGCATGGGGGACAGTGATGATGG + Intronic
901435965 1:9247596-9247618 GGCAAGGGTAACACTGTGCAGGG - Intronic
901455659 1:9361498-9361520 GCCACAGGGGACAGTGGGCTGGG - Intronic
901473281 1:9472438-9472460 GGCGGGGGGGACAGGGGACAGGG - Intergenic
901709989 1:11106229-11106251 AGAAAGGGGGACATTTGGCATGG - Intergenic
901784105 1:11613226-11613248 GGCAAGAGGGAGCTTGGGCAGGG - Intergenic
901857537 1:12054024-12054046 GGCAAGGGAGGCAGATGGCAGGG - Intergenic
902768198 1:18630733-18630755 GGGAAGGGGGCCAGGGCGCAAGG - Intergenic
903278918 1:22239085-22239107 CGCGAGGGTGACAGTGGGCTGGG - Intergenic
903295516 1:22340908-22340930 GGCAAGGGGTAGAAAGGGCATGG + Intergenic
903324899 1:22563950-22563972 GGACTGGGGGACAGTGGGAAAGG + Intronic
903583060 1:24386905-24386927 AGCAAAGGAGACAGTGGGTAGGG - Intronic
903648418 1:24908777-24908799 GACATGGGAGACAGTGTGCAAGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903790840 1:25891860-25891882 GGCAGGAGGAACACTGGGCAGGG + Intronic
903996487 1:27308076-27308098 GGGAAGCAGGACAGGGGGCAGGG - Exonic
904320509 1:29695106-29695128 AGCAAGTGGGAGGGTGGGCAGGG - Intergenic
904373049 1:30062765-30062787 GGTAAGGGGGGAAGTGTGCAAGG - Intergenic
904437214 1:30506669-30506691 GGAAAGTGGGAGGGTGGGCAGGG + Intergenic
904565389 1:31425429-31425451 GGCATGGGGGGCTGTGGGGAGGG + Intronic
904565969 1:31428681-31428703 GAGGAGGGGGACAGTGGGCCAGG + Intronic
904586774 1:31585071-31585093 GGCAAGGAGCTCCGTGGGCATGG + Intronic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
905019065 1:34796015-34796037 GGCATGGGGGAGGGAGGGCAAGG - Intronic
905019074 1:34796031-34796053 GGCCAGGGCGACGATGGGCATGG - Intronic
905116434 1:35645287-35645309 GGGAAGGGGGAAGGTGGGCTTGG + Intergenic
905271324 1:36789606-36789628 GGCAAGGTGGACTCTGGGCCAGG - Intergenic
905272720 1:36797448-36797470 TGCCATGGGGACAGAGGGCACGG + Exonic
905807622 1:40888273-40888295 GGCAAGGGGGTCAGTGTGGCTGG - Intergenic
906033141 1:42735823-42735845 GGCAAGGGGGCCACTGGGTGGGG + Intronic
906191250 1:43900833-43900855 GGTAGGTGGGACAGTGGGGAAGG + Intronic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
906477881 1:46182050-46182072 GGCAAGGGAGACAGAGGTCTTGG + Intronic
906652296 1:47521405-47521427 GGCAAGGGGGTAGATGGGCATGG - Intergenic
906789314 1:48644704-48644726 GGCAAGGTGGACAGTTGGAGAGG + Intronic
907269200 1:53280746-53280768 GCCAAGGGGGACACAGGGCATGG + Intronic
908931124 1:69316615-69316637 GGCAAGGCGGACAGCTGGCTGGG - Intergenic
909081063 1:71112204-71112226 GGCGAGGGGGGGAGTGGGGAGGG + Intergenic
912451129 1:109768459-109768481 GCCAAGGGGTGAAGTGGGCAGGG - Intronic
913090696 1:115474870-115474892 GGAAGGTGGGACAGGGGGCAAGG - Intergenic
913661305 1:121008574-121008596 GGCGAGGGGGGCAGTGGGTAGGG - Intergenic
914012673 1:143791754-143791776 GGCGAAGGGGGCAGTGGGTAGGG - Intergenic
914165158 1:145169430-145169452 GGCGAGGGGGGCAGTGGGTAGGG + Intergenic
914651300 1:149700363-149700385 GGCGAAGGGGGCAGTGGGTAGGG - Intergenic
915474750 1:156147031-156147053 CCCAAGGGGAACAGGGGGCAGGG + Intergenic
916206373 1:162319660-162319682 GGCACTGAGGACAGTGGGGAGGG - Intronic
917471987 1:175333887-175333909 GGAAAGGAGGACAGTTGGCTAGG + Intronic
917929694 1:179814598-179814620 GGAAAAGGGGACAGAGGGCAAGG + Exonic
918426632 1:184417159-184417181 GGGAAGGGTGACTGTAGGCAAGG + Intronic
919845644 1:201640487-201640509 GACAGGGGGAAAAGTGGGCAAGG - Intronic
919888878 1:201955589-201955611 GAGAAGGAGGGCAGTGGGCAGGG - Intronic
919924666 1:202186209-202186231 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
919924670 1:202186217-202186239 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
919924674 1:202186225-202186247 GGGAAGGGGGCAAGGGGGCAAGG - Intergenic
921527040 1:216230113-216230135 TGCAAGGAGGACAGTGGGTTGGG + Intronic
921540309 1:216406043-216406065 GGGAAGGGAGACAGTGGGCATGG + Intronic
921793643 1:219318378-219318400 GGGATGGGGGACTGTGGGGAGGG - Intergenic
922500776 1:226095480-226095502 GGCAGCAGGGACTGTGGGCAGGG + Intergenic
922978069 1:229801568-229801590 GGATGGAGGGACAGTGGGCACGG + Intergenic
923328739 1:232902983-232903005 GGGAAGGGGGTCGGGGGGCAGGG + Intergenic
923568433 1:235093672-235093694 AGCAAGGGGGACTGCGGGGAGGG - Intergenic
1064648677 10:17485990-17486012 GGCAAGAGAGACAGTGGCCCAGG + Intergenic
1065159268 10:22902323-22902345 GGCAAGAGAGAGAGTGTGCAGGG + Intergenic
1068284031 10:54911774-54911796 GGCAAGAGAGACAGAGTGCAAGG - Intronic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1069621656 10:69841055-69841077 GGGCAGGGGGGCAGTGGGGAGGG - Intronic
1069830419 10:71279308-71279330 GGCAAGCGGGACAGGAGCCAGGG - Intronic
1069931531 10:71885422-71885444 GGCAGGAGGGAAAGTGGGGAAGG - Intergenic
1070158584 10:73851623-73851645 GCAGAGGGGGACATTGGGCATGG + Intronic
1070678739 10:78434100-78434122 TGCAGGGGGGACTGTGAGCATGG + Intergenic
1070757306 10:79001296-79001318 GGCATGGGGGACCGAGGGTATGG + Intergenic
1071508153 10:86245277-86245299 GGCAAGTGGGCCAGTGGCCTGGG + Intronic
1071600410 10:86956140-86956162 GGCAAGGGGAGCAGGGGGCGGGG - Intronic
1072490756 10:95903963-95903985 GGGAAGGGGGACAGAGGGAAAGG + Intronic
1072716842 10:97757793-97757815 GGCAAGGGTGTCAGAGGTCAAGG + Intronic
1072806399 10:98426208-98426230 GCCAAGCAGGGCAGTGGGCAGGG + Intronic
1072921521 10:99581059-99581081 GCCAAGGGAGGAAGTGGGCATGG + Intergenic
1072960164 10:99922275-99922297 GTTAAGGGGTACAGTGGGAAGGG - Intronic
1073172136 10:101519499-101519521 AGGAAGGGGGACAGCTGGCAAGG - Intronic
1073458783 10:103653652-103653674 GGCAGGTGGGGCAGTGAGCATGG - Intronic
1073841903 10:107507317-107507339 GGCAAGAGAGACAGAGGGGACGG - Intergenic
1073922151 10:108471160-108471182 GGCAAGGGGGCCCCTGGGCCTGG + Intergenic
1074078522 10:110150534-110150556 GGGAAGGCGGACAGCTGGCAGGG - Intergenic
1074291462 10:112140649-112140671 GCCAAAGGAGCCAGTGGGCAGGG + Intergenic
1074326411 10:112455392-112455414 GGGAAGGGGGAAAGGGGGGAAGG - Intronic
1075700636 10:124467377-124467399 GGCAGGGTGGAGAGGGGGCAGGG + Intronic
1075716478 10:124558609-124558631 GGGTTGGGGGCCAGTGGGCAGGG + Intronic
1076068499 10:127467769-127467791 GGCAAGGGAGGCAGAGGACATGG - Intergenic
1076701517 10:132275611-132275633 GGCCACGGGGCCAGTGGCCAGGG + Intronic
1076790676 10:132775194-132775216 GGCAGGGAGGAGAGGGGGCAGGG + Intronic
1076838432 10:133032776-133032798 GTCAAGGGAGAAAGTGGACACGG + Intergenic
1077284759 11:1760723-1760745 GCCAAGCAGGACAGAGGGCAAGG + Intronic
1077371868 11:2186107-2186129 GCCCAGGCGGACAGTGGGGAGGG - Intergenic
1077474848 11:2781509-2781531 GGCCAGAGGGGGAGTGGGCAGGG - Intronic
1078155614 11:8797523-8797545 GGAAAGGGGGAAAGGGGGAAGGG - Intronic
1078498190 11:11841695-11841717 GGCAGGGAGGACAGTGGGCCTGG + Intronic
1078870738 11:15342304-15342326 GGGAAGGCGGGAAGTGGGCAGGG - Intergenic
1079026050 11:16948836-16948858 TGGAAGCGGGAAAGTGGGCAAGG - Intronic
1080844540 11:36015313-36015335 GGCAATGGGGGCAGGGGGCGGGG - Intronic
1081677323 11:44978116-44978138 GGCAGAGGGGGCAGTGGGGATGG + Intergenic
1081783939 11:45733184-45733206 AGCAAGGGCAGCAGTGGGCAGGG + Intergenic
1083268044 11:61556043-61556065 GGGAGGGGGGGCAGTGTGCAGGG + Intronic
1083487513 11:62992977-62992999 GGGAAGGTGGCCAGTGGGGAAGG + Exonic
1083512233 11:63220745-63220767 TGTCAGGGGGAAAGTGGGCATGG - Intronic
1083657391 11:64236052-64236074 GGCAGGTGGGGCAGCGGGCAGGG + Intronic
1083847572 11:65344988-65345010 GGCAAGGGGGCCAGCAGGAAAGG - Intronic
1083968715 11:66059154-66059176 GGGAAGGGGCTCAGAGGGCAGGG + Intronic
1084585948 11:70062592-70062614 GGGGAGGGGGACACTGGGCAAGG - Intergenic
1084771609 11:71346098-71346120 GGCAGCAGGGACAGTGAGCAAGG - Intergenic
1084985781 11:72870017-72870039 AGCAAGTGGGACAGTGGGGTGGG - Intronic
1085275061 11:75293065-75293087 GGCAAGGGGCACAGTGAGGGTGG + Intronic
1085302312 11:75465923-75465945 GGCAAGGCTGACAGGGGGCCAGG + Intronic
1085311207 11:75518006-75518028 GAGAAAGGGGACAGTGGGAAGGG + Intronic
1085610572 11:77945127-77945149 GGCAAGGGAGACAGTGTGGCAGG - Intronic
1088591968 11:111411304-111411326 GGCAAGGGGGTCAGTGTGCCTGG - Intronic
1088663277 11:112069591-112069613 GCCAAGGTGGATAGTGGGAAAGG + Intronic
1089258114 11:117204662-117204684 GCCAAGGAGGACAGTGGACTTGG - Exonic
1089693167 11:120199221-120199243 GGCAATGGGGAGATGGGGCAGGG - Intergenic
1090442699 11:126737341-126737363 GGCACAAGGCACAGTGGGCAGGG + Intronic
1090805341 11:130198802-130198824 GGCAGGGAGGCCAGTGGGCGTGG + Intronic
1091826494 12:3516790-3516812 GGCGAGGGGGAAGGTGGGGAGGG - Intronic
1091836439 12:3589404-3589426 GGCAAAGTGGACACTGGACACGG + Intronic
1092000810 12:5030445-5030467 GGTAAGGGGGAAAGTGAGCAAGG - Intergenic
1093287799 12:17286899-17286921 TGCAAGGGGGCCAGTGGGTCAGG + Intergenic
1093889200 12:24499225-24499247 GGCAGGGGGGACGATGGGGATGG - Intergenic
1094524275 12:31221422-31221444 GGCCAGTGAGTCAGTGGGCAGGG + Intergenic
1095628271 12:44343554-44343576 GGCCTGGGGGACAGGGGACATGG + Intronic
1096025096 12:48353509-48353531 GGGAATGGGGACAGTGAGGATGG - Intergenic
1096214597 12:49792270-49792292 TGCAAGGAGGGCAGTGGGGAGGG + Intronic
1096908739 12:54961300-54961322 GCCAAGGGGGAAAGGGGGTAAGG + Intronic
1097066242 12:56322812-56322834 GGGAATGGGGACAGAGGACAGGG + Intronic
1098788658 12:74791784-74791806 GGAAAGGGGGACAATGAGAATGG + Intergenic
1103053772 12:117802674-117802696 GGGGAGGGGGACATTGGTCAGGG + Intronic
1103155944 12:118684987-118685009 GGGAAGGGAGAGAGTGGGCTAGG + Intergenic
1103443386 12:120979338-120979360 GGCAAGGGGGACATTTCCCAGGG + Intronic
1103568466 12:121829064-121829086 AGCAAGGGAGGCAGTGGGCATGG + Intronic
1103895293 12:124269178-124269200 GGCAAAGGGGACACTGCGGATGG + Intronic
1103911578 12:124355122-124355144 TGCAAGGGGCTCAGAGGGCATGG - Intronic
1104031119 12:125066142-125066164 GGTCAGGGGGACAGAGTGCACGG - Intronic
1104720340 12:131041831-131041853 GGAAAGGAGGACCGTGGGGAGGG - Intronic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1104849015 12:131862290-131862312 GGCCAGCGTGACAGTGGGCAGGG + Intergenic
1104937917 12:132376393-132376415 AGAAAGGGGGACAGGGGGCAGGG + Intergenic
1106052659 13:26206194-26206216 GGGACGGGGGGCAGTGGGGAGGG - Intronic
1106657132 13:31758362-31758384 GGCAAGGATGACTGTGGGAACGG + Exonic
1107006732 13:35620449-35620471 GGCAAGGAGGCCAGTGGGCCAGG + Intronic
1107434806 13:40372911-40372933 TGGGAGGGGGAGAGTGGGCAGGG - Intergenic
1108576586 13:51796456-51796478 GGTGAGGGGGGCAGTAGGCAAGG + Intronic
1109108940 13:58291808-58291830 GGCAAAAGAGACAGTGTGCAGGG - Intergenic
1110735267 13:78928768-78928790 GGGACAGGGGACAGAGGGCAGGG - Intergenic
1112265546 13:97920219-97920241 GGAGTGGGGGACAGGGGGCAGGG - Intergenic
1112504585 13:99968473-99968495 GCCACCGGGGACAGTGCGCAGGG + Intronic
1113120303 13:106917716-106917738 GGGAACGGGGACAGGGCGCAGGG + Intergenic
1113120316 13:106917753-106917775 GGAAACGGGGACAGGGCGCAGGG + Intergenic
1113503494 13:110796730-110796752 GGCAAAGGGAGCAGTGGCCAGGG + Intergenic
1114532288 14:23403510-23403532 GGCCATGGGGGCAGAGGGCAGGG + Intronic
1114615309 14:24065067-24065089 TTCAAGGGGGACAGGGGGCCGGG + Exonic
1117396641 14:55317150-55317172 GGGAAGGGGTAGAGTGGGCTCGG + Intronic
1117548685 14:56812609-56812631 GGCCTTGGGGACAGTGGGCATGG + Intergenic
1117580251 14:57144485-57144507 GGGAAGGGAGACAGTGGGTGGGG - Intergenic
1117711482 14:58533811-58533833 GGCAAGGGGGAGAGAGGGAGAGG - Intronic
1118028775 14:61799369-61799391 AGCAAAGGGGAAAGTGGGCAGGG - Intergenic
1118604348 14:67491963-67491985 AGCAAGGGGCACAGAGGGGAAGG - Intronic
1118876907 14:69793682-69793704 GGCCATGGGGACAATGGGCTTGG - Intronic
1119007897 14:70949737-70949759 GGTAAAGTGGAAAGTGGGCAAGG - Intronic
1119410450 14:74426722-74426744 GGGAAGGGGGACAGGGGGAGGGG - Intergenic
1119438851 14:74614696-74614718 GGCAAGGTGAGAAGTGGGCAGGG - Intergenic
1120703699 14:87725802-87725824 GACTTGGGGGAGAGTGGGCAGGG - Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121465140 14:94111031-94111053 GGCTTGGGGTAAAGTGGGCAAGG + Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122131057 14:99604626-99604648 GGGGAGGGGGACGGTGGGAAAGG + Intergenic
1122464009 14:101918378-101918400 GGCAAGGGGGTGAGGGGACAGGG - Intronic
1122718709 14:103710096-103710118 GGCATGGGGAGCAGGGGGCAGGG + Intronic
1122829830 14:104390417-104390439 GGCACCGGGGACAGGGTGCAGGG + Intergenic
1122906398 14:104803544-104803566 GGCATGGGTGAAAGTGGCCATGG + Exonic
1123034691 14:105467105-105467127 GCCAGGCGGGACAGTGGGGAGGG + Intronic
1123068372 14:105629286-105629308 GACGACGGGGACCGTGGGCAGGG - Intergenic
1123092391 14:105747610-105747632 GACGACGGGGACCGTGGGCAGGG - Intergenic
1123813660 15:23954989-23955011 GGGACAGGGGACAGGGGGCAGGG + Intergenic
1123933247 15:25181984-25182006 GGCAAGCGGGTCACTGGGCTTGG - Intergenic
1124097586 15:26662938-26662960 GCCTTGGGGGACACTGGGCATGG - Intronic
1124218847 15:27832217-27832239 GGAAAGGGGGCCAGTGGGGTAGG - Intronic
1124881108 15:33643551-33643573 GGCGAGGAGGAGAGTGGGCTAGG + Intronic
1125343977 15:38700416-38700438 GGCAGGAGGGAGAGAGGGCAGGG + Intergenic
1125509474 15:40285081-40285103 GGCAAGGGGTTCAGGGTGCAGGG - Intronic
1125519412 15:40339777-40339799 GGCCAGGGGTAGGGTGGGCATGG - Intronic
1125676008 15:41502912-41502934 GGCAAGGGCGTCTCTGGGCAGGG + Intronic
1125676437 15:41504729-41504751 GGGGAGGGGAACAGTGGGGAAGG + Intronic
1125815537 15:42580916-42580938 GGGAAGGGGGACAGGAGACAGGG + Intronic
1125898788 15:43326312-43326334 GGCAAGGCGATCAGTGGGCCAGG - Exonic
1126727832 15:51651016-51651038 GGCAAAGGGGCCAGTGGGAATGG - Intergenic
1126799975 15:52289564-52289586 GGCAAGGGGGCTGGTAGGCAGGG - Intronic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128109660 15:65068230-65068252 GGCTAGGGGGAGAGAGGGGAAGG + Intronic
1128334677 15:66778393-66778415 GGACAGGGGCACAGGGGGCAGGG - Intronic
1128722952 15:69965548-69965570 GGGAAGGGGGAAATTGGGAAGGG + Intergenic
1129294619 15:74593108-74593130 GGACAGGGAGACAGTGGGCCTGG - Intronic
1129525699 15:76212727-76212749 GGCAAGGCTGGCAGAGGGCAGGG - Intronic
1129763724 15:78147895-78147917 GGCAGGGGTGACATTGGGGATGG + Intronic
1129868297 15:78925292-78925314 GCCAGGAGGGACAGTGGGGAGGG - Intronic
1130398784 15:83529818-83529840 AGCAATGATGACAGTGGGCAGGG + Intronic
1130844213 15:87729382-87729404 GGAAATGGGGCCAGTGGGAAGGG - Intergenic
1131455269 15:92578680-92578702 GGTGAGGGGAACAGTAGGCAGGG - Intergenic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133756907 16:8768716-8768738 CGCAAGGCTGTCAGTGGGCAGGG - Intronic
1133771231 16:8868349-8868371 GGAAAGGGGGCCTGTGGGCGCGG + Exonic
1133935767 16:10267970-10267992 GGCAGAGGTTACAGTGGGCAAGG + Intergenic
1134101606 16:11456467-11456489 AGCAAGGGGGAGAGTGGGGTGGG + Intronic
1134308545 16:13055663-13055685 GGGAAGAGGGTGAGTGGGCATGG - Intronic
1135040890 16:19115710-19115732 CGCAAGGGGGCCCCTGGGCAAGG + Exonic
1135102330 16:19616860-19616882 GTTAAAGGGCACAGTGGGCAGGG - Intronic
1135950541 16:26910068-26910090 GGGAAGGGGGACAGTAGGACAGG - Intergenic
1136169906 16:28482625-28482647 GGAAAGGTGGACAGTGTTCAAGG - Exonic
1136341168 16:29644520-29644542 GGAAAGGGGGCCATAGGGCACGG - Intergenic
1136378517 16:29879593-29879615 GGCAGGCTGGAGAGTGGGCAGGG - Intronic
1137685567 16:50384503-50384525 GGCAAGGGTGGCAGTGGAGATGG - Intergenic
1138100317 16:54246866-54246888 GGCATGGGTGACAGTGGGCTGGG + Exonic
1138539649 16:57680232-57680254 GGCCAGGGGAACAGAGGGAAAGG - Intronic
1138928543 16:61622635-61622657 AGCAAGGGAGACAGAGGGCAAGG + Intergenic
1139276799 16:65735349-65735371 AGGAAGGGGGACAGTGGAGAGGG + Intergenic
1140195223 16:72849511-72849533 GGCAGTGTGGAAAGTGGGCAGGG - Intronic
1140661558 16:77194599-77194621 GGCAAGGGGCACACAGCGCACGG - Exonic
1140946269 16:79770862-79770884 GGAAAGGGGGAGGGTAGGCAGGG - Intergenic
1141172434 16:81699896-81699918 GGCACGGGGGGCAGTGGGTGAGG + Intronic
1141296159 16:82771786-82771808 GGCAAGAGGGAGACTGAGCAAGG + Intronic
1141323752 16:83036599-83036621 GGGAAGAGGGAAAGTGGGAAGGG - Intronic
1142121703 16:88389758-88389780 GGCAAGGGAGTGAGTGGCCATGG + Intergenic
1142126104 16:88411447-88411469 GGCAGGGGTGCGAGTGGGCAGGG + Intergenic
1142176224 16:88646681-88646703 GGCCGGTGGGACAGTGGGGAGGG + Intronic
1142578843 17:927830-927852 GGTGAGGGGGCGAGTGGGCACGG - Intronic
1143303067 17:5925225-5925247 GGCAAGAGGGACAGTCAGCCAGG - Intronic
1143457218 17:7076090-7076112 GGCAGTGGGGACAGTGGCCTAGG + Exonic
1143498262 17:7324561-7324583 GGCAAGGTGGACTGTGGGCTCGG - Intronic
1144269459 17:13602138-13602160 GGAATGGGGGACACTGGGGAAGG - Intergenic
1144686923 17:17232224-17232246 GGCAAGGGGTACTCTGAGCAGGG - Intronic
1144730712 17:17524471-17524493 GGGGTGGGGGACACTGGGCATGG + Intronic
1144735413 17:17552904-17552926 GGCCTGGGGGAAAGGGGGCAAGG - Intronic
1144899162 17:18568397-18568419 GGCTAGGTGGACAGTGAGGAAGG + Intergenic
1145072110 17:19819501-19819523 GGTAGGAGGGACAGTGAGCATGG - Intronic
1145835418 17:27951063-27951085 GGCAAAGGGGAGAGAGGGCTAGG - Intergenic
1146260458 17:31417110-31417132 GGTGAGGGGGACAGTGGGGAAGG - Intronic
1146317679 17:31821026-31821048 AGCAAGGGTGACACTGGGAAGGG - Intergenic
1147240043 17:39084821-39084843 GGCAGGGGGCGCAGTAGGCACGG + Intronic
1147418643 17:40311131-40311153 GACAAGGAGGCCACTGGGCAGGG - Intronic
1147493388 17:40892890-40892912 GGCAAGGGGGACACTGGGACAGG + Intergenic
1147536163 17:41324416-41324438 GGCAGGCGGGACAGTGGGAGAGG + Intergenic
1147556766 17:41484613-41484635 GGCAGGGGGGGCAGTTGGCATGG - Intergenic
1149607545 17:57935709-57935731 GCCAAGGTGGACCGTGGCCATGG - Intronic
1150652359 17:67018339-67018361 GGAAAGAGAGACACTGGGCATGG + Intronic
1150843139 17:68628119-68628141 GGCTAGTGGGAGGGTGGGCAAGG + Intergenic
1151345422 17:73498460-73498482 GGCAAGGAGGACAATCGGAAAGG - Intronic
1151772850 17:76176758-76176780 AGCAAGCGGGACACTGGCCAAGG - Intronic
1152691979 17:81722457-81722479 GGAGAGGAGGCCAGTGGGCAGGG + Intergenic
1152704981 17:81838766-81838788 GGCGAGGGGCCCAGGGGGCAGGG - Intergenic
1152863367 17:82708977-82708999 GGGCATGGGGGCAGTGGGCAGGG - Intergenic
1152863453 17:82709206-82709228 GGCATGAGGGTCAGTGGGCAGGG - Intergenic
1153810022 18:8744185-8744207 GGAAAGGGTGCCAGTGGGCCCGG - Intronic
1153819710 18:8823090-8823112 GGACATGGGGACAGTGGGGAGGG - Intronic
1153912090 18:9713302-9713324 GGGAAGGGGGATGGTGGGGAGGG + Intronic
1153966847 18:10190142-10190164 GGCCAGGTGGACACTGGGGACGG + Intergenic
1155170520 18:23263747-23263769 GGCCAGGCGGTCAGTTGGCAAGG + Intronic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1156444382 18:37224181-37224203 GGAATGGGTGACTGTGGGCATGG - Exonic
1157332213 18:46712288-46712310 GGCTAGGGTGCCTGTGGGCATGG - Intronic
1157370184 18:47103730-47103752 GGCCATGGAAACAGTGGGCATGG - Intergenic
1158005991 18:52672657-52672679 GGGAAGGGGGGAAGGGGGCAAGG - Intronic
1158543069 18:58374445-58374467 GGAAAGGGGGGCAGTGGGGAGGG - Intronic
1158602124 18:58864113-58864135 GGCCAGTGGGAGAGGGGGCACGG - Intronic
1158714601 18:59866788-59866810 GGCAATGGGTACAGTGGGATGGG + Intergenic
1160025013 18:75209477-75209499 GGCGGGGGGGACGGCGGGCAAGG + Intergenic
1160240224 18:77117986-77118008 GGGATGGGGGACAGTGGGTTGGG + Intronic
1160240285 18:77118131-77118153 GGGATGGGGGACAGTGGGTTGGG + Intronic
1160240306 18:77118180-77118202 GGGATGGGGGACAGTGGGTTGGG + Intronic
1161016544 19:1986375-1986397 GGCCTGGGGGACACTGGGCCTGG + Exonic
1161089268 19:2352060-2352082 GCCAAGGGGGACAGGGGACAGGG - Intronic
1161328065 19:3672897-3672919 GGGCGGGGGGAGAGTGGGCAGGG + Intronic
1161441971 19:4296912-4296934 GGCAAAGGGGACAGTGCATAGGG + Intronic
1161718398 19:5890205-5890227 GCCATGGAGGACTGTGGGCAGGG + Intronic
1162200383 19:9015636-9015658 GTCACAGGGGACACTGGGCATGG + Intergenic
1162548928 19:11347690-11347712 GGCAAGGGTGACAGAGAGAAAGG + Intronic
1162648015 19:12064243-12064265 GGAAAAGGGGAGAGGGGGCATGG + Intergenic
1163379063 19:16952251-16952273 CTCAGGGGGGCCAGTGGGCATGG + Intronic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1163513942 19:17751732-17751754 GGAATGGGGGACGGGGGGCAGGG - Intronic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1164459841 19:28437415-28437437 GTCAGAGGGGACAGTGAGCAGGG - Intergenic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1164718665 19:30415160-30415182 GGAGAGGGAGACAGGGGGCAGGG - Intronic
1165017461 19:32891226-32891248 GGCAATGGAGGCATTGGGCAGGG - Intronic
1165406989 19:35637096-35637118 GACAAGGTAGACACTGGGCAAGG + Intronic
1165476316 19:36032812-36032834 GGCAAGGGAGACAGAGAGAAGGG + Exonic
1165865205 19:38932702-38932724 GGCTGGGGGCACAGTGGGCTGGG + Exonic
1165994292 19:39833412-39833434 GGCAAGCGGGACAGGAGGCCCGG + Exonic
1166103995 19:40588802-40588824 GGTAAGGGGGTCAGTGGGGTGGG - Intronic
1166104467 19:40590515-40590537 GGAAAAGGGGTCAGAGGGCAAGG - Intronic
1166338375 19:42122466-42122488 GGCAGGGGTCACCGTGGGCAGGG - Intronic
1166442292 19:42825401-42825423 GTCGAGAGGGACAGAGGGCACGG - Intronic
1166461739 19:42993710-42993732 GTCAAGAGGGACAGAGGGCGCGG - Intronic
1166479019 19:43153668-43153690 GTCAAGAGGGACAGAGGGCGCGG - Intronic
1166501687 19:43346008-43346030 GTCAAGAGGGACAGAGGGCGCGG - Intergenic
1166508428 19:43387450-43387472 GTCAAGAGGGACAGAGGGCGCGG + Intergenic
1166820860 19:45578949-45578971 GGAAAGGGGGACAGTTTGTATGG - Intronic
1167322458 19:48805598-48805620 GGGAAGGGGGACAGTCGGTGGGG - Intronic
1167409910 19:49338559-49338581 GGAGTGGGGGACAGTGGGCTGGG - Intronic
1168145552 19:54418635-54418657 AGCAGGGGAGACAGTGAGCAGGG + Intronic
1168681368 19:58318337-58318359 GGCAAGGGGGTCACTGGGCTTGG + Intergenic
925447757 2:3942659-3942681 GGCAGGTGGGCAAGTGGGCAGGG + Intergenic
925986168 2:9216887-9216909 GACAAGGGGGAGGCTGGGCACGG - Intronic
926120964 2:10241023-10241045 GCCTAGGGGGCCAGCGGGCAGGG - Intergenic
926172110 2:10558975-10558997 GGCAATGGGGACTGTGGCCCTGG - Intergenic
926299262 2:11590427-11590449 GCTGAGGGGGACAGTGGGCTGGG - Intronic
927158456 2:20236044-20236066 GGCAGGGGAGCAAGTGGGCAGGG + Intergenic
927488362 2:23504558-23504580 GGGAGGGGGCACAGGGGGCAGGG + Intronic
927654615 2:24934941-24934963 GGAAAGGGGGAAAGTGAGCTTGG - Intergenic
927713559 2:25340131-25340153 GGCAGGCGGGAGGGTGGGCAGGG - Intronic
928035047 2:27815143-27815165 GGCATTGAGGGCAGTGGGCATGG + Intronic
928946366 2:36775433-36775455 GGCATGGGGGATGGTTGGCAAGG + Intronic
929559159 2:42945100-42945122 GGGAGGGAGGGCAGTGGGCACGG + Intergenic
929776717 2:44934928-44934950 GGGAAGGGGGACAGGGGACCCGG - Intergenic
931343534 2:61425749-61425771 GGGAAGGGGGACAGGAAGCAGGG + Intronic
932610331 2:73194519-73194541 GGGAAGGGGGCAAGGGGGCAAGG + Intergenic
932773484 2:74514303-74514325 GGGGAGGGGGACAGGGGGCCAGG - Intronic
932894100 2:75622145-75622167 GGCAAGGGTAACAGTGGGAGTGG - Intergenic
933978373 2:87529870-87529892 GGCCATGCGGGCAGTGGGCAGGG - Intergenic
934033224 2:88066427-88066449 GGGGTGGGGGGCAGTGGGCAGGG - Intergenic
934561957 2:95318046-95318068 GGTAGGGGTGACAGGGGGCAGGG + Intronic
934775371 2:96933809-96933831 GGCAAGGGGGCAAGAGGGCCAGG + Intronic
934781262 2:96971203-96971225 GGGGAGGGGCACAGTGGGAAAGG - Intronic
936251830 2:110873597-110873619 AGCAGTGGGGACAGTGGTCAAGG - Intronic
936315459 2:111420931-111420953 GGCCATGCGGGCAGTGGGCAGGG + Intergenic
937140490 2:119595988-119596010 AGCAAGGGGAGCAGTGTGCAAGG + Intronic
937305834 2:120870115-120870137 GGCAAGGGGGTGAGGGAGCACGG - Intronic
937910113 2:127071453-127071475 GGCTGAGGGGACAGTGGGCTGGG + Intronic
937918541 2:127113671-127113693 GGAAAGCAGGACAATGGGCAGGG - Intergenic
937982144 2:127622111-127622133 GGCAGGGGTGAGAGCGGGCAGGG + Intronic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938021452 2:127908953-127908975 GCCAAGGAGCACACTGGGCAGGG + Intergenic
938118234 2:128616573-128616595 GGCAAGGGGGACAGTGCAGAGGG + Intergenic
938403880 2:131016458-131016480 GGCATGGGGGGCACTGGGCAGGG - Intronic
939039629 2:137172523-137172545 GGTATGGGGGACAGAGTGCAGGG - Intronic
942129940 2:172868476-172868498 GGGAAGGGAGACAGAGGGGAAGG + Intronic
942259193 2:174140651-174140673 GGCAAAGGGGATTTTGGGCAGGG - Intronic
943195754 2:184746677-184746699 GGGGAGGGGGAAAGTGGGGATGG - Intronic
943900826 2:193433412-193433434 GGGAAGGGGGAAAGTGAGTAAGG + Intergenic
943907355 2:193516368-193516390 GGGAAGGGGGGGAGTGGGGAGGG + Intergenic
944994487 2:205278205-205278227 GGCAGGGGGTACAGAGAGCAAGG + Intronic
945846248 2:214948505-214948527 GGCAGGGGGGACAGTGGGTGTGG + Intronic
946100402 2:217315623-217315645 GGTAGGGGGCACAGTGGGCCAGG - Intronic
946131688 2:217611530-217611552 GGCAAGAGTGAGAGTGAGCAGGG - Intronic
946141645 2:217696115-217696137 GGTAATGGTGTCAGTGGGCAGGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946349856 2:219143019-219143041 GGCACAGGGGACAGTAGGCCAGG - Intronic
946504298 2:220282487-220282509 GGCAAGAGGGAAAGTTGGAACGG + Intergenic
946739183 2:222785162-222785184 GACAAGGTGGACAGTGGCCTAGG + Intergenic
946755033 2:222935922-222935944 GGGAAGGGGGAGAGAGGGAAGGG - Intronic
948425715 2:237885672-237885694 GGCAGGGAGGTCAGTAGGCAGGG - Intronic
948912560 2:241011776-241011798 TGGAAGGGGGCTAGTGGGCAAGG - Intronic
1169318256 20:4610682-4610704 GGCTTGGGGGACAGGGGCCATGG + Intergenic
1169910010 20:10640337-10640359 GCCAAGGGAGAGATTGGGCATGG - Intronic
1170604431 20:17865060-17865082 GACTAGGGGGCCAGTGTGCATGG + Intergenic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172778209 20:37420332-37420354 GGCATGGGGGAAAGAGGGCCGGG - Intergenic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173400552 20:42722285-42722307 GGCAGTGGAGACAGTGGGCATGG - Intronic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173621401 20:44439640-44439662 GACAAGGGGGCCACTTGGCAAGG + Intergenic
1173647502 20:44642595-44642617 GGCAAAGTGGAGAGGGGGCAGGG + Intronic
1173725982 20:45298139-45298161 GGCATGGGACACAGTGGGCTGGG - Intronic
1174387050 20:50193483-50193505 GGCAAAGGGATCAGTGGGCAGGG - Intergenic
1175501812 20:59456145-59456167 GACAGTGGGGACAGTGGGGAGGG + Intergenic
1175549176 20:59805615-59805637 GGCTGGGGGGACAGTGGGCAGGG + Intronic
1175581235 20:60101598-60101620 TGCAAGAGTGAGAGTGGGCATGG + Intergenic
1176138942 20:63536844-63536866 AGCACGGGGGTCAGAGGGCACGG - Intronic
1176195904 20:63836240-63836262 GGCAGGGGAGAGCGTGGGCAGGG + Intergenic
1176289825 21:5037982-5038004 GGGGAGGGGGACAGTGGGGAGGG - Intronic
1176289846 21:5038034-5038056 GGGGAGGGGGACAGTGGGGAGGG - Intronic
1177256716 21:18672588-18672610 TGCAGAGGGGACAGTGGGGATGG + Intergenic
1178957852 21:37039698-37039720 GGGAAGGGGGAAAGGGGGAAGGG - Intergenic
1179201621 21:39228288-39228310 GGGCCGGGGGACGGTGGGCATGG - Intronic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1179867405 21:44225605-44225627 GGGGAGGGGGACAGTGGGGAGGG + Intronic
1180757476 22:18172750-18172772 GGGAGGGGAGACAGAGGGCAAGG - Intronic
1180971873 22:19820133-19820155 GGCAGGATGGGCAGTGGGCAGGG + Intronic
1181008427 22:20025849-20025871 GCCAAGGGGGACAGTCTGGAGGG + Intronic
1181074300 22:20364698-20364720 GGGAGGGGAGACAGAGGGCAAGG + Intronic
1181609393 22:24002325-24002347 GGCCATGGGGACAGAGGGAAGGG + Intergenic
1181935205 22:26433489-26433511 GGAAAGTGGAGCAGTGGGCACGG + Exonic
1182102974 22:27670712-27670734 GGGAAGGGGGAAGGTGGGGAAGG - Intergenic
1182356213 22:29723282-29723304 GGCATGGAGGGCAGTTGGCAGGG + Intronic
1182511846 22:30825576-30825598 GGCAAAGGGGAGAATGGCCAAGG - Intronic
1182675074 22:32032658-32032680 GGCAGATGGGGCAGTGGGCAAGG - Intergenic
1183184436 22:36284062-36284084 GGCAAAGGGGCGGGTGGGCAGGG + Intronic
1183311504 22:37112308-37112330 GGGACGAGGGACAGTGGGCAGGG - Intergenic
1183368141 22:37417929-37417951 GGCGAGGGGGAGAGAGGGGAGGG + Intronic
1183464923 22:37974849-37974871 AGCAAGGAAGACAGTAGGCATGG - Intronic
1183704678 22:39469381-39469403 AGCAAGGAGGGCAGTGGGCATGG - Intronic
1184074673 22:42168705-42168727 TGCAAGGGGGGGAGAGGGCACGG + Exonic
1184310069 22:43635432-43635454 GACAAGTGGCACAGTTGGCATGG + Intronic
1184454420 22:44601015-44601037 GGCAATGGGGGCAATGGGGAGGG + Intergenic
1184528612 22:45040415-45040437 GGCCAGGTGGGCAGTGGGAATGG - Intergenic
1184769103 22:46587614-46587636 TGGATGGGGGTCAGTGGGCAAGG + Intronic
1185043116 22:48515766-48515788 GGACTTGGGGACAGTGGGCAAGG + Intronic
1185207628 22:49549180-49549202 GGGAAGGGGGAAAGTGCTCAGGG - Intronic
1185251047 22:49801877-49801899 GACACGTGGGCCAGTGGGCAGGG - Intronic
1185399455 22:50608370-50608392 GAAAGGTGGGACAGTGGGCAGGG + Intronic
1185399500 22:50608536-50608558 GAGAGGTGGGACAGTGGGCAGGG + Intronic
1185399543 22:50608702-50608724 GAGAGGTGGGACAGTGGGCACGG + Intronic
1203292790 22_KI270736v1_random:11510-11532 GGCAGGAGAGACAGTGTGCAGGG + Intergenic
949506941 3:4737406-4737428 TGAAAGGGGGAAATTGGGCATGG + Intronic
950182621 3:10926237-10926259 GGAATGGGGGACGGTGGGCAGGG - Intronic
950203842 3:11062915-11062937 GCCAAGGGGGTCAGTGGGCCTGG + Intergenic
950477014 3:13221042-13221064 GGCAGGGAGGCCAGTGAGCAGGG + Intergenic
950620705 3:14203054-14203076 GGCAGGGAGGCCAGTCGGCATGG + Intergenic
951520483 3:23606466-23606488 GGCCAGGGGATCAGGGGGCAGGG + Intergenic
953749795 3:45600528-45600550 GGCAACGGGGACAGGGGGTGGGG - Intronic
953947946 3:47164660-47164682 GGCAAGGGAGAGAGAGGGCGAGG - Intergenic
954060808 3:48065465-48065487 GGCAAGGGGGACAGAAATCAAGG + Intronic
954696653 3:52431010-52431032 GGAAAGAGGGACAGTGGGTAGGG - Intergenic
955009923 3:55003910-55003932 GGTAAGGGAGACAGGGAGCAAGG + Intronic
955215675 3:56983359-56983381 GGCAGGGGTCACAGTGGGGAGGG - Intronic
955879650 3:63530045-63530067 GGCATGGGGGTCAGGGTGCAGGG - Intronic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
957602478 3:82355922-82355944 AGCAAGGAGCACAGTGTGCATGG - Intergenic
957903556 3:86529937-86529959 GACAAGGGGGCAAGTGGGAATGG + Intergenic
959917901 3:111838369-111838391 GGAAAGAGGGATTGTGGGCAGGG - Intronic
960454478 3:117853597-117853619 GGCAAGAGGAAAAGTAGGCAGGG + Intergenic
961117301 3:124341532-124341554 GCCAAGTGGGGCAGTGGGGAAGG + Intronic
961537731 3:127580199-127580221 GGGAAGGAGGACAGTGGCCCAGG - Intronic
962157634 3:132965285-132965307 GGCATGGGGGACAGTGTGACAGG + Intergenic
962317359 3:134367204-134367226 GGCAAGGGTGCGAGTGTGCAAGG + Intronic
962740189 3:138357664-138357686 GGCCAGGCGGCCAGTGGGCATGG - Intronic
963430546 3:145196879-145196901 GGGATGGGGGACAGAGGGGAAGG - Intergenic
964436503 3:156659000-156659022 GGAAAGGGGAGAAGTGGGCAGGG - Intergenic
965429493 3:168568749-168568771 GGCCAGGGGGCCAGGGGGCCAGG - Intergenic
965429498 3:168568757-168568779 GGCCAGGGGGCCAGGGGGCCAGG - Intergenic
965606002 3:170498095-170498117 GGGAAAGGGGACAGTAGGGAAGG - Intronic
966863156 3:184241721-184241743 GGCCAGGTGGACAGTGGGCGGGG + Exonic
966887740 3:184386176-184386198 GGCAGTGGGGGCAGTGGGGAGGG + Intronic
966910693 3:184558252-184558274 AGCAAGGGGGCCAGTGGAGAGGG + Intronic
967535151 3:190593614-190593636 GGCAAGAGAGACTGTGTGCAGGG + Intronic
968086623 3:195876803-195876825 GGCAAGGCGGGCAGTGGGAGGGG - Intronic
968577936 4:1376616-1376638 TGCAGAGGGGAAAGTGGGCAGGG - Intronic
968647929 4:1749286-1749308 GGGAGGGGGGGCAGTGGGGAGGG - Intergenic
968647953 4:1749334-1749356 GGGAGGGGGCACAGTGGGGAGGG - Intergenic
968664361 4:1812821-1812843 GGCAGAGGGGACAGTGGGATGGG + Exonic
969101423 4:4771643-4771665 GGGGGGTGGGACAGTGGGCAGGG + Intergenic
969108406 4:4825698-4825720 AGCATGGGGCACACTGGGCATGG + Intergenic
969448903 4:7261813-7261835 GGGAAGGGGCCCTGTGGGCATGG + Intronic
969501993 4:7558964-7558986 GGCAGGAGGGACATCGGGCAGGG - Intronic
969511847 4:7622583-7622605 GGCAAAGAGGAAGGTGGGCAGGG - Intronic
970647988 4:18145325-18145347 GGCAGGAAGGAGAGTGGGCAAGG - Intergenic
971032913 4:22660380-22660402 GGAAAGTGGGAGAGTTGGCAAGG + Intergenic
972669754 4:41203998-41204020 AGCAAGTGGGAAAGTGGACAAGG - Intronic
973339124 4:48986263-48986285 GGCAAGTGGGTCAGTTGGCTGGG + Exonic
973637246 4:52871495-52871517 GGGAAGGAGGACTGTGGCCATGG - Intergenic
974787891 4:66644515-66644537 TGCCAGGGGTACAATGGGCAAGG + Intergenic
976079572 4:81340324-81340346 TGGAAGGGGGAGAGTGGGGAGGG - Intergenic
976321865 4:83725492-83725514 GGGAAGGGGGAAAGAGGGGAAGG - Intergenic
976478330 4:85510579-85510601 GACAAGGGGGAGAGAGGGGAGGG - Intronic
977611321 4:99035191-99035213 AGAAAGGGGGAAAGTGGCCAAGG - Intronic
979276049 4:118815429-118815451 GGTAAGGCGGACAGGGTGCAGGG - Exonic
979643586 4:123039530-123039552 CACAAGGGGGACTGTGGACAAGG - Intronic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
980244779 4:130224609-130224631 TGCAAGGAGCACAGTGGGAAGGG + Intergenic
980566597 4:134550825-134550847 GGCAAGATGCACAGTGGGGAAGG - Intergenic
981558778 4:146024418-146024440 GGCTATGGGGACAGGCGGCAGGG - Intergenic
984635086 4:182101607-182101629 GGCAGGGGGGATGATGGGCAGGG + Intergenic
985824897 5:2184955-2184977 GGCAAAGGGGAGAGGGGACATGG - Intergenic
986240330 5:5954831-5954853 GGCAAGGAGGAAAGGGGGGAAGG - Intergenic
986305611 5:6512106-6512128 GGCCAGGGGGGAACTGGGCAAGG + Intergenic
987234198 5:15927252-15927274 TGCAAGGGGGACAGAGCCCATGG + Intronic
987253300 5:16122540-16122562 GACAAGGTGGTCATTGGGCATGG - Intronic
987255738 5:16149140-16149162 GGTAAGGAGGACACTGGGCAAGG - Intronic
987299629 5:16585819-16585841 GGCAAGAGGGAGTGTGGGGAGGG + Intronic
992367419 5:76106782-76106804 GGCAAGGGGGATTGTGAGTAGGG - Intronic
992865016 5:80949528-80949550 TGTAATGGGGAAAGTGGGCAGGG - Intergenic
994187001 5:96826275-96826297 GGGAACGGGGACAGTGGGGGAGG - Intronic
995071683 5:107930006-107930028 AGGAAGGGTGACAGTGGCCATGG - Intronic
996683725 5:126257218-126257240 GGCATGGACTACAGTGGGCAGGG - Intergenic
997427942 5:133817010-133817032 GGCAAGTGAGGCAGTGGGCCTGG - Intergenic
997492581 5:134290511-134290533 TGCAAAGGGGCCAGTGGGCCTGG + Intronic
998077501 5:139248370-139248392 GGCAAGGGGGGCAGAAGGAAAGG + Intronic
998145386 5:139724907-139724929 GGTAAGAGGGGCAGTGGGCCTGG + Intergenic
999420771 5:151440498-151440520 GGGAAAGGGGACACTGGGTAGGG + Intronic
999636864 5:153632155-153632177 GGAAAAAGGGAAAGTGGGCAAGG + Intronic
999981673 5:156963674-156963696 GGCAAGGAGGCCAGGGGACAGGG - Intergenic
1001653609 5:173331620-173331642 GGCAAGGAAAAAAGTGGGCATGG + Intergenic
1001859351 5:175039796-175039818 TCCAAGGAGGACAATGGGCAAGG - Intergenic
1002164540 5:177336295-177336317 GGCAGGGGGAGCAGTGAGCAGGG + Intronic
1002288013 5:178178233-178178255 AGCAAGGGAGAAAGTGAGCAAGG + Intergenic
1002303952 5:178272731-178272753 GGGTAGGGGGACAAGGGGCAGGG - Intronic
1002360875 5:178669790-178669812 GACAAAGGGGAGAGTGGTCAAGG + Intergenic
1002879548 6:1238747-1238769 GCCCAGGGGGACTGTGGGGATGG - Intergenic
1003032993 6:2618913-2618935 GGCTAGGAGCACAGTGGGGAGGG - Intergenic
1003149241 6:3534858-3534880 GGCAAGGGGGACAGCCAGGAGGG - Intergenic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1005582192 6:27245985-27246007 GGCAAGGGAGTGAGTGGGGAGGG - Intergenic
1005935849 6:30520457-30520479 GGCAGTGGGGCCAGTGGGCTGGG + Intergenic
1006072012 6:31505255-31505277 GCCAGAGGGGACAGTGGGAATGG - Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006195913 6:32242266-32242288 AGCAAGCAGGACACTGGGCATGG - Intergenic
1006320953 6:33319139-33319161 GCCAAGGGGGAAGGTGGGCTGGG + Exonic
1006814181 6:36839601-36839623 GGCTAGGGGCCCAGTGGGGAAGG + Exonic
1007308951 6:40929783-40929805 GGCTAGATGAACAGTGGGCAAGG - Intergenic
1007634093 6:43287618-43287640 GGAAAGTGGGCCAGTGGGGAGGG + Exonic
1007727776 6:43927031-43927053 GGGAAGGGGGACAGAGGGCCCGG + Intergenic
1008140387 6:47824994-47825016 GGCCAGGGGGAGAGTGGAAAGGG + Intronic
1008796097 6:55304893-55304915 GGCAAGGGGCAGAATGGACAGGG - Intergenic
1008876810 6:56338453-56338475 GGCCAGGGTGAGAGGGGGCAGGG - Intronic
1009842614 6:69095383-69095405 AGCATGGGGGGCAGGGGGCAGGG + Intronic
1012570992 6:100728754-100728776 GGCAAAGGAGAGAGTGGGAAAGG - Intronic
1013418768 6:109947660-109947682 GGCATGGAGGGCAGGGGGCAGGG - Intergenic
1013565424 6:111354920-111354942 GGCAAGGGGCACGGAGGGGAAGG + Intronic
1014019068 6:116567040-116567062 GGCAAGAGAGACAGTGGTGAGGG + Intergenic
1015020406 6:128466578-128466600 AGCAAGGGGGATAGTAGGCATGG + Intronic
1015377867 6:132531183-132531205 GGCAAGAGAGACCGTGTGCAGGG - Intergenic
1016982389 6:149864595-149864617 GGGAATGGGGGCAGTGGGAAGGG + Intergenic
1017019791 6:150130887-150130909 GGCAAGGGGTGGAGAGGGCAGGG + Intergenic
1017183167 6:151573722-151573744 GGCAAGAGAGAGAGTGTGCAGGG + Intronic
1017510862 6:155113236-155113258 GGGAAAGGGCACCGTGGGCAGGG - Intronic
1018887907 6:167957027-167957049 GGCTGGAGGGCCAGTGGGCAAGG - Intronic
1018957424 6:168419581-168419603 GGGAAGGGGGAGAGAGGGGAAGG + Intergenic
1019322214 7:420920-420942 GGGACGGGGGAGAGTGGGCGGGG - Intergenic
1019376738 7:696856-696878 AGAAAGGGGGACAGCGAGCAGGG + Intronic
1019411006 7:906764-906786 GACATGGGGGACAGGGGACACGG + Intronic
1019660161 7:2219665-2219687 GGCAAGGGGGGCAGAGGGCAGGG + Intronic
1019759929 7:2803389-2803411 GGCAGGTGGGACAGGAGGCAGGG + Intronic
1019919743 7:4155930-4155952 GGCACGGGGGACAGCAGGCAGGG + Intronic
1022174530 7:27860842-27860864 GGCAAAGAGGAAAGTGGGGATGG - Intronic
1022209734 7:28196659-28196681 GGGAAGGGGCACACTGGGGAGGG - Intergenic
1022489420 7:30805246-30805268 GTCAAGGAGGACTGTGGGCCTGG + Intronic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023527533 7:41120353-41120375 GGCAAAGGGAACAGTCAGCAGGG - Intergenic
1023551488 7:41374538-41374560 GGCAAGGGTGTCAGGGGGCCAGG + Intergenic
1023834448 7:44060096-44060118 GGCCAGGGGCTCAGTGGGCAAGG + Exonic
1024006024 7:45225235-45225257 AGCTAGGGGGACCGTGGGCTGGG + Intergenic
1024544855 7:50508617-50508639 GGCAAGGGGCACATTTGGCAGGG - Intronic
1024599764 7:50970096-50970118 GGCACAGGTGACAGTGGTCAGGG + Intergenic
1025093687 7:56082101-56082123 GGCAAGGGAGGAAGTAGGCAGGG - Intronic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1026031893 7:66801515-66801537 GGCATGGGGGATAGTGGGGATGG - Intronic
1026738860 7:72965942-72965964 GGCCAGGGAGACGTTGGGCAAGG + Exonic
1026789870 7:73324572-73324594 GGCCAGGGAGACGTTGGGCAGGG + Exonic
1026828422 7:73597456-73597478 GGCAGGAGGGACGGTGGGGAAGG + Exonic
1027104874 7:75399127-75399149 GGCCAGGGAGACGTTGGGCAAGG - Exonic
1030130227 7:106193620-106193642 GGGAGTGGGGACAGTGAGCAGGG + Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031575950 7:123416094-123416116 GCCCTGGGGTACAGTGGGCATGG + Intergenic
1031863723 7:127013539-127013561 GGGGATGGGGGCAGTGGGCAGGG + Intronic
1032076199 7:128837274-128837296 GGCAGGGGGGAAAGGGGGCAGGG + Intronic
1032087543 7:128891709-128891731 GGCGAGGCTGGCAGTGGGCATGG + Exonic
1032095394 7:128935645-128935667 AGCAAGATGGACAGTGGGAAGGG + Intergenic
1032281975 7:130511145-130511167 GGCAAAGGGCAGAGTGGGAAAGG + Intronic
1032699268 7:134364450-134364472 GGCATGGGGGTCAGTGGGCGTGG + Intergenic
1033470786 7:141647180-141647202 GGAGAGGGAGACAGTGGGCTAGG - Intronic
1033649032 7:143326651-143326673 GGCAAGGAGGATGGTGGGCAAGG + Intronic
1034350093 7:150409799-150409821 GGCAGAGGGGGCAGTGGGGAGGG - Intronic
1034989881 7:155541732-155541754 GGCCAGGAGGACAGTGTGGATGG + Intergenic
1035112172 7:156492293-156492315 GGCAGTGGGGACAGTGAGCAGGG - Intergenic
1035389854 7:158497001-158497023 GGGAAGGGGGAGAGGGCGCAGGG - Intronic
1035398025 7:158547765-158547787 GGCCAGGTGGACAGGGGGTACGG - Intronic
1036390359 8:8319129-8319151 GGCAGGGGGGTGTGTGGGCAGGG + Exonic
1036439307 8:8766141-8766163 GGCAGCAGGGACTGTGGGCAAGG + Intergenic
1036493902 8:9252054-9252076 GGGAAGGGGGAGAGGGGGGAAGG + Intergenic
1036767526 8:11558215-11558237 GGCAGGAGGCACAGTGGCCAGGG - Intronic
1036807061 8:11842486-11842508 GGTGAGGGAGACAGTGCGCATGG + Intergenic
1037922664 8:22818495-22818517 AGCAAGGGGGAGGGTGGACATGG + Intronic
1038128449 8:24700931-24700953 GGCAAGGACTACACTGGGCAAGG - Intergenic
1038698534 8:29827985-29828007 GGCCTGGGTGACAATGGGCAGGG - Intergenic
1041023186 8:53658548-53658570 GGCTAGGGAGACAGAGGGCATGG - Intergenic
1041104212 8:54425531-54425553 GGCAACAGGGACAATGGGAAAGG + Intergenic
1041433967 8:57817488-57817510 GGCAGTAGGGGCAGTGGGCAGGG - Intergenic
1044445120 8:92266253-92266275 GACATGGAGGACAGTGGGGATGG + Intergenic
1046285948 8:112092766-112092788 GGCAAGGTGCACAGGAGGCAGGG + Intergenic
1046921849 8:119739158-119739180 GGCAAGGGGAACAAGGAGCAAGG - Intronic
1047342728 8:123998829-123998851 GGCTAGGGCGGCAGTGGTCATGG - Intronic
1047696237 8:127406277-127406299 GGGAAGGGGGAAAGGGGGAAGGG + Intergenic
1047725684 8:127682194-127682216 GGCAAGAGTGAAAGTGTGCAAGG + Intergenic
1048515457 8:135105270-135105292 GGCTAGGGGGATGGTGGGAATGG - Intergenic
1049255862 8:141613465-141613487 GGCCATGGGGAGAGTGGGCTGGG + Intergenic
1049342515 8:142120794-142120816 AGTAAGGTGGGCAGTGGGCAAGG - Intergenic
1049398377 8:142412483-142412505 GGCAAGGGGCAGTGTGGGCTGGG - Intergenic
1049441617 8:142612315-142612337 GGCATTGGGGAGAGTGGGCCGGG - Intronic
1049687510 8:143944810-143944832 GGGGAGGGGAGCAGTGGGCAGGG + Intronic
1049820015 8:144627833-144627855 GGCAAGGGGTCCAGGGTGCAGGG - Intergenic
1049970549 9:818339-818361 GGCAAGGAGGATAGGAGGCAGGG - Intergenic
1051245909 9:15110610-15110632 GGGAAGGGGGAATTTGGGCAAGG + Intergenic
1052733979 9:32321281-32321303 GGGTAGGGGGACAGTGAGGATGG + Intergenic
1053145367 9:35708244-35708266 GGCATGTGGGAAAGAGGGCAGGG - Intronic
1053441130 9:38117375-38117397 GGGAAGGCGGACAGTGCACACGG - Intergenic
1054766367 9:69045817-69045839 GGTAAGGGGGGAAGTGTGCAAGG + Intronic
1055944477 9:81680526-81680548 GGCAAGGGAGTCCCTGGGCATGG - Intronic
1056604482 9:88075554-88075576 GGCAGGGGGGAAAGAGGGTAGGG - Intergenic
1057146358 9:92761775-92761797 GGGAAAGGGCACAGTGGGAACGG + Intronic
1057629993 9:96711860-96711882 GGCAATGGGAGCAGTGGGAAAGG - Intergenic
1057770689 9:97965185-97965207 GGGAAGAGGGGCACTGGGCAAGG - Intergenic
1059226886 9:112680768-112680790 GACAAAGGGGACAGTGGGAATGG + Intergenic
1059506907 9:114807440-114807462 GGGACGGGTGACAGTGAGCAGGG - Intergenic
1059922904 9:119177990-119178012 GGAAAGGTGGAGAGTGGGGAAGG + Intronic
1060102780 9:120855531-120855553 GGCAAGGTGGCCAGAGGACAGGG + Intergenic
1060496826 9:124125502-124125524 GGCAGTGGGGTCTGTGGGCAGGG - Intergenic
1060740043 9:126092002-126092024 GGCAAGGAGGACATTGTGAAGGG + Intergenic
1060821599 9:126664446-126664468 GCCAAGGGGCCCTGTGGGCAAGG + Intronic
1060851046 9:126876170-126876192 GGGAAGGGGGAAAGGGGGGAAGG - Intronic
1060975844 9:127764546-127764568 GGCCATGGGGTCAGTGTGCAAGG - Intronic
1061372613 9:130206255-130206277 GACAGAGGGGACAGTGGGCCTGG - Intronic
1062170452 9:135132111-135132133 GGCAAGGCGGGGTGTGGGCACGG + Intergenic
1062346399 9:136117266-136117288 GGCCTTGGGGACAGTGGCCAGGG + Intronic
1062432658 9:136532943-136532965 GGCCAGGTGGGCAGTGGGAATGG - Intronic
1062519780 9:136952836-136952858 GGCAGGGGTGGCAGTGGGCAGGG - Intronic
1062519786 9:136952852-136952874 GGCAGGGGCGGCGGTGGGCAGGG - Intronic
1062599769 9:137314597-137314619 GGGCGGGGGGACAGGGGGCAAGG - Intronic
1186706535 X:12145861-12145883 GGCAAGGGTGACTGTGTTCAGGG - Intronic
1187406468 X:19009045-19009067 GGCAATTGGGAGAGTAGGCAGGG - Intronic
1187500257 X:19833296-19833318 GGCAAGGAGGACTGTGGGAAGGG - Intronic
1189149298 X:38688041-38688063 GGTAAGGGGGAGAGGGAGCAGGG - Exonic
1189560351 X:42185708-42185730 GGCCAAGAGGACTGTGGGCAAGG + Intergenic
1189643908 X:43105553-43105575 AGCCTGGGGGACAGAGGGCAAGG - Intergenic
1189882798 X:45509363-45509385 GGCTAGGGAGACAGTGGTCAGGG - Intergenic
1190020235 X:46867648-46867670 GGAAAAGGGGACAGTGGGGTGGG - Intronic
1190059077 X:47199394-47199416 GGGAAGGGGGAAAGGGGGAAGGG - Intronic
1190111324 X:47590812-47590834 GGCAACGGGGACAAGGAGCAGGG - Intronic
1190248431 X:48705752-48705774 GGCCATGGGGAAAGGGGGCAAGG - Intronic
1190367417 X:49709368-49709390 GGGGAGGGGGACAGGGGGTAAGG + Intergenic
1190427317 X:50345542-50345564 AGGAAGGGAGAGAGTGGGCAAGG - Intronic
1190435438 X:50419910-50419932 GGCAAAGAGCACAGTGGTCAAGG + Intronic
1191945330 X:66527980-66528002 GGCAAGAGGAACAGTCAGCAGGG + Intergenic
1192535310 X:71922369-71922391 GGCAAGGGGGACAAAGGGAAAGG + Intergenic
1192567122 X:72174282-72174304 TGGGTGGGGGACAGTGGGCAGGG - Intergenic
1193183406 X:78484475-78484497 GGCAAGAGGGAGCGTGTGCAGGG + Intergenic
1195168894 X:102246992-102247014 GGCTCGGGGGACGGGGGGCAGGG - Intergenic
1195189963 X:102440094-102440116 GGCTCGGGGGACGGGGGGCAGGG + Intronic
1195697265 X:107676482-107676504 GGGAAAGGGGAAAGTGGCCAGGG - Intergenic
1196303477 X:114072632-114072654 GGCTATGGGGGCAGTGGGGAAGG + Intergenic
1197199580 X:123736281-123736303 GGGATGGGGGCCAGGGGGCAGGG + Intergenic
1197507639 X:127327488-127327510 GGCAAGGGGGAGTGTGTGCAGGG + Intergenic
1198307840 X:135400360-135400382 GGCAACAGGGACAGAGGGGAGGG - Intergenic
1199270325 X:145874628-145874650 GGCAAGAGAGACAATGTGCAGGG + Intergenic
1199489146 X:148379548-148379570 GACAAGGAGGACAGAGGGAAGGG + Intergenic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1200163375 X:154020114-154020136 GGCGTTGGGGACAGAGGGCAGGG + Intergenic
1200254563 X:154573179-154573201 GGCAAGGGAGACAGCAGGCAAGG + Intergenic
1200263206 X:154631229-154631251 GGCAAGGGAGACAGCAGGCAAGG - Intergenic