ID: 904842205

View in Genome Browser
Species Human (GRCh38)
Location 1:33379659-33379681
Sequence GAGGGTGAGCACACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904842205_904842207 -7 Left 904842205 1:33379659-33379681 CCATCCTCAGTGTGCTCACCCTC 0: 1
1: 0
2: 5
3: 34
4: 342
Right 904842207 1:33379675-33379697 CACCCTCCCTCACTCTGCCTTGG 0: 1
1: 2
2: 7
3: 82
4: 550
904842205_904842212 1 Left 904842205 1:33379659-33379681 CCATCCTCAGTGTGCTCACCCTC 0: 1
1: 0
2: 5
3: 34
4: 342
Right 904842212 1:33379683-33379705 CTCACTCTGCCTTGGCTCTCTGG 0: 1
1: 0
2: 3
3: 90
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904842205 Original CRISPR GAGGGTGAGCACACTGAGGA TGG (reversed) Intronic
900360171 1:2284551-2284573 TGGGGTGAGCCCACTGGGGAAGG - Intronic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
900900175 1:5510705-5510727 GCAGATGAGCAGACTGAGGAAGG + Intergenic
901742817 1:11353348-11353370 GAGGCTCTGCCCACTGAGGAAGG - Intergenic
901763074 1:11483115-11483137 GAGAGTGAGCTCACTGGGGGAGG - Intronic
902377329 1:16036028-16036050 GAGAGTGAGCACAGTGGGGGCGG - Intergenic
902382507 1:16059282-16059304 GAGAGTGAGCACAGTGGGGGCGG - Intronic
902673815 1:17994354-17994376 GCGGGTGTGCACACTGGGGGAGG + Intergenic
902761593 1:18584311-18584333 GAGAGTGAGCAATTTGAGGAAGG + Intergenic
903134974 1:21303269-21303291 GAGGGTGAGGCCGCTGGGGATGG - Intronic
903575550 1:24337603-24337625 GAGGGAGAGGACAGTGAGGCTGG - Intronic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
905013446 1:34761975-34761997 CAGGGAGGGCACCCTGAGGATGG + Exonic
905127664 1:35726901-35726923 GAGGGTGAACACCCTAAGGGAGG + Intronic
905186353 1:36199852-36199874 TAGGGTGAGGGCACTGGGGACGG - Intergenic
905256821 1:36690111-36690133 GATGGTGGGGACACTTAGGATGG - Intergenic
905881723 1:41468360-41468382 GAGGGTGAGGGCTCTGTGGACGG - Intergenic
906161150 1:43650027-43650049 TAGGCTGAGCACACTGAGGTCGG + Intergenic
907244321 1:53098231-53098253 CAGGGTGAGTATACTGAGGCGGG - Intronic
907924729 1:58944639-58944661 GAGGGCGTGCACACTGAAGTGGG + Intergenic
909054694 1:70807202-70807224 GGGTGTGTGCACACTCAGGATGG - Intergenic
909384159 1:75036509-75036531 GAGGGTGAGCACAAGCAGGGTGG + Intergenic
909849613 1:80444042-80444064 GAGGTTGAGCAAACTGAAAAAGG + Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910270578 1:85390107-85390129 TAGGGTGAGGACACTGAGGCAGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912043561 1:105422335-105422357 GGGGGTGAGGACACTGAGGGTGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
915165495 1:153945957-153945979 GAGGGGGAGGAGGCTGAGGAAGG + Intronic
915692297 1:157701709-157701731 AAGGTTGGGCACCCTGAGGATGG - Intergenic
918455124 1:184703696-184703718 GAGAGTGAGCACCCTGAGACAGG - Intronic
919283721 1:195526053-195526075 GAGGGAGAGCAAAGTGAGTATGG + Intergenic
919796319 1:201323388-201323410 GAGGGTGGGCCCACTGATGCTGG + Intronic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
920848683 1:209613859-209613881 GAGGGCGAGGAAACTGGGGAAGG - Exonic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
923454446 1:234151098-234151120 GATGGGGCCCACACTGAGGAGGG + Intronic
924148591 1:241103310-241103332 GAGGGTGAGGAAACTGGGCATGG + Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
1063477962 10:6345184-6345206 GTGTTTGAGCACACTGAGAAGGG - Intergenic
1065844866 10:29736023-29736045 GAGGGTGGGGACACAGAGGGGGG + Intronic
1067582121 10:47452493-47452515 AGAGGTGAGGACACTGAGGACGG - Intergenic
1067684810 10:48459768-48459790 GAGCGCGGGCTCACTGAGGAGGG - Exonic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1068531269 10:58189389-58189411 GAGTGGGAGGACACTGAAGAAGG - Intergenic
1068933646 10:62616000-62616022 GTAGATGAGAACACTGAGGATGG + Intronic
1069890671 10:71650371-71650393 AAGGGTGATCACACAGAGGAAGG + Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1074867802 10:117555049-117555071 GAGGCTGGGGACACTGAGGCGGG + Intergenic
1075058450 10:119237687-119237709 GAGGGGGAGGGAACTGAGGAGGG + Intronic
1076171747 10:128325700-128325722 AAGGGCGAGCGCACTGAGGCTGG - Intergenic
1076193807 10:128500731-128500753 GAGGGCGAACAGCCTGAGGAAGG + Intergenic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076293832 10:129368488-129368510 GAGGATGAGGAAACTGAGGCAGG + Intergenic
1076319014 10:129564632-129564654 GAGGGTGAGGAAGCAGAGGAGGG - Intronic
1077133052 11:984212-984234 GATGGTGAGCTCACGGAGGCAGG - Intronic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1078905960 11:15688011-15688033 GATGATGAGCACCCTGAGGCTGG - Intergenic
1082003869 11:47409116-47409138 GAAGGTGAGGAAACTGAGGCAGG + Intronic
1084497439 11:69513262-69513284 GAGGGTGTGGAAACTCAGGAAGG - Intergenic
1084609552 11:70193573-70193595 GAGGGTGAGGAGACTCAGGAAGG - Intergenic
1084935834 11:72586190-72586212 GGGGGTGGGCTCACTCAGGAGGG + Intronic
1084955948 11:72691689-72691711 GAGGCTGAAGACACTGGGGATGG + Intronic
1086442796 11:86846098-86846120 GAGTGAAAGCACACTGTGGAAGG - Intronic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1088812301 11:113399981-113400003 GAGGTTGATGACACTCAGGAAGG - Exonic
1088836304 11:113580506-113580528 GAGGGACAGCAGTCTGAGGAAGG - Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089535692 11:119159723-119159745 GACGGTGTCCACCCTGAGGAAGG - Intronic
1089914806 11:122143257-122143279 GAGGGTAAGAAATCTGAGGATGG - Intergenic
1090857479 11:130623074-130623096 GGAGGTGAGCCCACAGAGGAAGG + Intergenic
1091135679 11:133186845-133186867 GAGGGTGAGGGAACTGAGGCTGG + Intronic
1091336075 11:134767280-134767302 GAGGGAGAGCAAGGTGAGGATGG + Intergenic
1093789735 12:23234558-23234580 GAGGGAAAGCACACTGGGGATGG + Intergenic
1096778953 12:53981234-53981256 GAGGCTGAGGACACTTAGCAGGG - Intergenic
1100869378 12:98894783-98894805 GAGGGCGAGCGCGCCGAGGAAGG + Intronic
1101633144 12:106515069-106515091 GAGGGTGAGCACATTAGGGCTGG + Intronic
1101693978 12:107107339-107107361 GAGGGTGAGGAACCTGCGGAAGG - Intergenic
1102435729 12:112921854-112921876 GAGGGCTATCACAGTGAGGAAGG - Intronic
1104993088 12:132637391-132637413 CAGGGTGAGCGCACCTAGGAGGG + Intronic
1106304730 13:28499265-28499287 GAGGTTGAGCAAACCAAGGAAGG + Intergenic
1107458025 13:40573034-40573056 TAGTGTGGGCACATTGAGGAGGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107938948 13:45367538-45367560 GAGGGAGTCCACTCTGAGGATGG - Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1109556764 13:63986521-63986543 GAGGTAGAGCCCACTGAAGAAGG - Intergenic
1109578388 13:64292597-64292619 GAGGGGGAGCACACGGTGGCAGG - Intergenic
1109656659 13:65400079-65400101 GGGAGTTAGCACACTGAGGAGGG + Intergenic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110946752 13:81430843-81430865 GAGGCTGAGCAGTCTTAGGATGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113557636 13:111251275-111251297 GAGAGAGAGCACCCTGAGGTGGG + Intronic
1113731583 13:112645378-112645400 GATGGCGAGGACAGTGAGGATGG + Intergenic
1113731588 13:112645405-112645427 GATGGCGAGGACACCGAGGACGG + Intergenic
1113731592 13:112645423-112645445 GACGGCGAGGACACCGAGGACGG + Intergenic
1113731604 13:112645477-112645499 GATGGCGAGGACACTGAGGATGG + Intergenic
1113731617 13:112645540-112645562 GATGGCGAGGACACAGAGGACGG + Intergenic
1113731631 13:112645612-112645634 GACGGCGAGGACACCGAGGATGG + Intergenic
1113899125 13:113786459-113786481 GATGGTGATGACACTGATGATGG - Intronic
1113957528 13:114107325-114107347 GAGGGTCAGGACACGAAGGAGGG - Intronic
1115221460 14:31062433-31062455 TAGGTTGAGAACCCTGAGGAGGG - Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117161618 14:52995342-52995364 GAGGGAGAGCACAGTGACTATGG - Intergenic
1119779322 14:77267721-77267743 GATGGTGAGCACCTTGAGGAAGG - Intronic
1121150330 14:91627574-91627596 TAGGGTCAGCAAACTGTGGAAGG + Intronic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1122299232 14:100722663-100722685 GTGGCTGAGCACACTGAGGCTGG - Intergenic
1122687773 14:103518206-103518228 GAGGCTGAGGGCAGTGAGGAAGG - Intergenic
1123037741 14:105478270-105478292 GAAGGTGAGCTCCCTGGGGAAGG + Exonic
1123132989 14:106001956-106001978 CACGGTGTGGACACTGAGGAAGG + Intergenic
1123147120 14:106142682-106142704 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123187250 14:106531565-106531587 GATGGTGTGGACACTGAGGAAGG + Intergenic
1123218285 14:106832175-106832197 TAAGGTGTGGACACTGAGGAAGG + Intergenic
1123223690 14:106879968-106879990 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123583016 15:21732402-21732424 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123619666 15:22174999-22175021 CATGGTGTGGACACTGAGGAAGG + Intergenic
1124474759 15:30023180-30023202 GAGGGTGAGCAGAATCAGGGTGG - Intergenic
1125285711 15:38090386-38090408 GAGAGAGAGCACACCCAGGATGG - Intergenic
1126069049 15:44849762-44849784 GTGAGTGAGCACACTGGGGCAGG - Intergenic
1126089767 15:45041011-45041033 GTGAGTGAGCACACTGGGGCAGG + Intronic
1126312962 15:47337721-47337743 GAGTGTGAGCACACTCATGAAGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1128901186 15:71423981-71424003 GAGGGAGAGCACAGTGATGTGGG - Intronic
1129769305 15:78193396-78193418 GAGGATGAGGACACTCTGGATGG + Intronic
1129787752 15:78320733-78320755 GAGGCTGAGCACTCCGAGGATGG + Intergenic
1129794915 15:78368864-78368886 GAACGTGAGAACCCTGAGGAGGG + Intergenic
1129820985 15:78601853-78601875 GAAGACGAGCACAGTGAGGAAGG + Exonic
1132147085 15:99435433-99435455 GAGGGTGGGGACAGTGAGGGAGG - Intergenic
1133025268 16:2986521-2986543 GAGAGTGAACACACTCGGGAAGG + Intergenic
1134264788 16:12683720-12683742 CAGGAAGATCACACTGAGGATGG - Intronic
1134269928 16:12724271-12724293 GAGGGTGAGCTCACTGGGGTAGG - Intronic
1134436563 16:14264036-14264058 GATGGTGAGTGCAATGAGGAAGG + Exonic
1134829838 16:17314008-17314030 GAGGGTCAGGACACTGGAGAGGG + Intronic
1136157786 16:28396239-28396261 TAGGGTGAGGAAACTGAGGCAGG + Intronic
1136205301 16:28719045-28719067 TAGGGTGAGGAAACTGAGGCAGG - Intronic
1136395076 16:29988080-29988102 GTAAGTGAGCAAACTGAGGAAGG - Exonic
1136680084 16:31955619-31955641 CACGGTGTGGACACTGAGGAAGG - Intergenic
1136871972 16:33815969-33815991 CATGGTGTGGACACTGAGGAAGG - Intergenic
1136875194 16:33848764-33848786 CACGGTGTGGACACTGAGGAAGG + Intergenic
1136889980 16:33962485-33962507 CACGGTGTGGACACTGAGGAAGG + Intergenic
1137761025 16:50940470-50940492 GAGGGTGAGGAGACTAAGGCAGG - Intergenic
1137762261 16:50950269-50950291 GATGGGGAGCAGGCTGAGGAAGG - Intergenic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1139374454 16:66488053-66488075 GAGGGTGAGAACGCTGGGCATGG - Intronic
1139938928 16:70590923-70590945 GAGGGGCAGCGCACTGACGACGG - Intronic
1141733107 16:85835332-85835354 GAGGCTGAGCACACAGAGGTGGG + Intergenic
1142140869 16:88472158-88472180 GTGGGTGTGGACACTGAGGCTGG - Intronic
1142169856 16:88616007-88616029 GAGGCTGAGCACACAGGAGACGG - Intronic
1203083054 16_KI270728v1_random:1161129-1161151 CACGGTGTGGACACTGAGGAAGG - Intergenic
1203094614 16_KI270728v1_random:1243417-1243439 CATGGTGTGGACACTGAGGAAGG - Intergenic
1203100200 16_KI270728v1_random:1300099-1300121 CATGGTGTGGACACTGAGGAAGG + Intergenic
1143297440 17:5882087-5882109 GAGGGTCAGCTCACTGAGGCTGG + Intronic
1143619291 17:8071984-8072006 GAGAGTGGGAACATTGAGGAAGG + Intergenic
1143724761 17:8837348-8837370 GACGGAGGGCACACTGAGGTCGG - Intronic
1143845311 17:9769241-9769263 GAGAGTGAGGACTCTGAGGCAGG - Intergenic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1145016275 17:19400425-19400447 GAGGGTGAGGACAGGAAGGAAGG - Intergenic
1146480852 17:33203748-33203770 TAGGGTGAGCACACTGGAGTGGG + Intronic
1147428128 17:40356016-40356038 GCGGGTGATCACGCTGAAGATGG + Exonic
1147537410 17:41329522-41329544 CAGGCTGACCACACTGCGGAAGG + Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148388348 17:47252860-47252882 GAGGGTGGGCACGCTGCGTAGGG + Intergenic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1152406010 17:80098311-80098333 GGAGGTGGGCACACAGAGGAGGG + Intronic
1152489416 17:80619736-80619758 GAGGGTTAACACACCCAGGAGGG - Intronic
1153502576 18:5763958-5763980 AAGGGTGAGAACACTGAAGGGGG - Intergenic
1156068081 18:33169931-33169953 GAGATTGAGAAAACTGAGGAAGG - Intronic
1156505345 18:37587158-37587180 GAGGGGCAGCCCACAGAGGAAGG - Intergenic
1157414364 18:47489750-47489772 GAGGGTGAGGTCACAGAAGAGGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159387283 18:67742463-67742485 GAGGCTGTGCCCATTGAGGAGGG - Intergenic
1160419116 18:78732074-78732096 GTGGGTGAGGACCCTGGGGAGGG - Intergenic
1160758598 19:771550-771572 GAGGGAGAGTAGACAGAGGAGGG - Intergenic
1161332657 19:3695656-3695678 GAGGCTGAGGACACTGGGGACGG - Intronic
1161660735 19:5544308-5544330 TAGGGTGAGCTCAGTGAGGCGGG + Intergenic
1161849573 19:6731525-6731547 GAGGGTGGGCACAGAGAGGGCGG + Intronic
1161973913 19:7598359-7598381 GAGGCTGGTCAGACTGAGGAAGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165590654 19:36966654-36966676 GAGGGTGTGGACATTGAAGAGGG + Intronic
1167030689 19:46957925-46957947 TACTGTGAGAACACTGAGGAGGG + Intronic
1167158345 19:47752630-47752652 GAGGCAGAGCCCACTGAGGAGGG - Intronic
1167597746 19:50436272-50436294 GAGAGTGGGCCCTCTGAGGATGG + Intronic
1168269257 19:55240886-55240908 GAGGGTGCGCCCACAGGGGATGG + Intronic
1168309802 19:55454745-55454767 GAGGGTCAGGGCACAGAGGAGGG - Intronic
925001992 2:410369-410391 GATGGTGTGGACAGTGAGGATGG - Intergenic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925719162 2:6811468-6811490 GAGGCTGAGCCCCCTGAGAATGG - Intergenic
925891657 2:8439524-8439546 GAGGGTGAGCCCCGGGAGGAAGG + Intergenic
926449027 2:12979938-12979960 TAGGGTGAGCAAAGTGAGAAGGG - Intergenic
927570406 2:24154006-24154028 GAGGGTGAGCCCAGTGAGTAGGG - Intronic
927728929 2:25452880-25452902 GAGGGTGATCATCCTGAAGATGG - Intronic
927939061 2:27092459-27092481 GAGGGAGAGCCCACTGGGGAAGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929537662 2:42793402-42793424 GAGGGCTAGGACACTGAGGCCGG - Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929744774 2:44645393-44645415 GAGGGTGAGCCCAAGGAGAAGGG + Intronic
930886132 2:56328983-56329005 CAGGAGGAGCCCACTGAGGAAGG - Intronic
931464403 2:62474007-62474029 CAGGGAGGCCACACTGAGGATGG + Intergenic
933012183 2:77080346-77080368 GAGAGTGTGCAGACTGAGAAAGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934036025 2:88088955-88088977 GAAGGTGAGCAGGCTGAGGACGG + Intronic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936514166 2:113171267-113171289 AAGGGTGAGCACACTGCCGTGGG - Intronic
937193958 2:120133442-120133464 GAGGGAGAGCACAGTGACTATGG + Intronic
938115590 2:128601348-128601370 GAGGGTGTGCACACACTGGACGG - Intergenic
938263860 2:129912660-129912682 CAGGGTGAGGGCACAGAGGAGGG + Intergenic
940375729 2:152956112-152956134 GAGAGTGAGAACACTGGAGAAGG + Intergenic
940433550 2:153623266-153623288 GAGGGAAAGCACGTTGAGGAAGG - Intergenic
940844825 2:158629202-158629224 GAAGGTAAGCACACCAAGGAGGG - Intronic
940971232 2:159899153-159899175 GAGTGGGAACAGACTGAGGATGG - Intronic
941937871 2:171000609-171000631 TAGGTTGAGTAGACTGAGGAGGG + Intronic
942128023 2:172846955-172846977 GAATGTGAGCAACCTGAGGATGG + Intronic
942879666 2:180844077-180844099 GAGGGTGAGAACACAGACCAAGG + Intergenic
944284013 2:197927378-197927400 GAGGGTGAATACATTGAGGAGGG - Intronic
945955546 2:216082616-216082638 GAGGGTGAGCCCGCTGAGGATGG + Intronic
947914734 2:233823779-233823801 GAGAATGAGCACTCAGAGGAGGG - Intronic
948011739 2:234654224-234654246 CAAGGAGAGCCCACTGAGGAAGG + Intergenic
948453421 2:238092806-238092828 GAGGGAAAGCACGCTGGGGAGGG - Intronic
1168854151 20:997198-997220 GAGATTGAGGCCACTGAGGAAGG - Intronic
1169472933 20:5903972-5903994 GAGGATGAGCACAGAGAGAAGGG + Intergenic
1169570722 20:6902301-6902323 GAGGGAGAGCAAACTGTGGTGGG + Intergenic
1169738719 20:8866711-8866733 CAGGGAGAGCAAACTGAGGCAGG - Intronic
1171017251 20:21553171-21553193 GAGGGGGAGGACCGTGAGGAAGG - Intergenic
1172106039 20:32517806-32517828 GAGGGTGAGCCTATTGTGGAGGG - Intronic
1172689350 20:36779553-36779575 CAGGGTGAGCCCAGTGAGAAGGG + Exonic
1173569595 20:44067756-44067778 GAGGGAGAGTGCAGTGAGGAGGG + Intronic
1174644259 20:52072026-52072048 GAGGGTCAGTGCACTAAGGATGG - Intronic
1175799110 20:61790962-61790984 GAGGGTGAGAGCACTGAGGATGG - Intronic
1175988113 20:62774358-62774380 GAGGTTGTGCACACAAAGGAAGG - Intergenic
1176141842 20:63548327-63548349 GGGGATGAGCACACGGAGAAGGG + Intronic
1178640022 21:34338050-34338072 GAGGGTGGGCACACGGAGAGGGG + Intergenic
1179539979 21:42077940-42077962 GAGGGAGGGCCCACTCAGGATGG - Intronic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1181270696 22:21657111-21657133 GAGGAACAGGACACTGAGGAGGG + Intronic
1181523092 22:23460459-23460481 GAGGGTGAGCGAGCTGAGGAAGG - Intergenic
1183272725 22:36872086-36872108 GGGGGTGAGCACACAGGGAAGGG - Intronic
1183467099 22:37985296-37985318 CAGGGTGAGCCCAGTGTGGAAGG - Intronic
1183654977 22:39179410-39179432 GGGAGTGAGCCCACTGAGGCTGG + Intergenic
1183682486 22:39341236-39341258 GAGGGTGAGCACACAGGGAAGGG - Intergenic
1183907140 22:41049995-41050017 GAGGGTGAGGAAACTGACCAAGG + Intergenic
1183922058 22:41177438-41177460 GTGGCTGAGCAGTCTGAGGAGGG - Exonic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184942632 22:47780433-47780455 GAGGGTGAGCAAGGTGAGGCAGG - Intergenic
1184989572 22:48157743-48157765 GAGGGTTTGCACTCTGAGGCCGG + Intergenic
1185114501 22:48923997-48924019 GAGGGTCAGAACGCTGAGGACGG + Intergenic
949529112 3:4936540-4936562 GATGCTGAACACCCTGAGGATGG - Intergenic
954852574 3:53616119-53616141 GAGGGTGAGCTCAGTTGGGATGG + Intronic
961614423 3:128167627-128167649 GAGGGTCAGCACACTAATGCCGG + Intronic
962028458 3:131573372-131573394 GAAGGTCAGCAGACTGAGAAAGG + Intronic
962382445 3:134908767-134908789 GAAGGTGAGGGCAATGAGGAAGG + Intronic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
963274221 3:143314332-143314354 AAGGGTCAGCACAGTGTGGAGGG - Intronic
963752826 3:149200978-149201000 GTGGGTGAGCAAACAGAGTATGG - Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
967496771 3:190150481-190150503 GAGAGGGAGCAAACAGAGGAAGG - Intergenic
968096042 3:195931514-195931536 GAGGTAGAGCACAGTGATGATGG + Intergenic
968096052 3:195931576-195931598 GAGGCAGAGCACAGTGATGATGG + Intergenic
968096063 3:195931638-195931660 GAGGTAGAGCACAGTGATGATGG + Intergenic
968096074 3:195931700-195931722 GAGGTAGAGCACAGTGATGATGG + Intergenic
968460236 4:721088-721110 GAGGCTGAGGACCCTGGGGAGGG + Intronic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
968737092 4:2303302-2303324 GAGGGTCCTCACACTGGGGAAGG - Intronic
968896839 4:3409241-3409263 GAGCAGGAGCACACTGGGGAGGG + Intronic
969107128 4:4815891-4815913 GAGGTGGAGCACACTGATGTTGG + Intergenic
969264850 4:6057678-6057700 GAGGGGGTGCACACAGAGGTGGG - Intronic
972573421 4:40330695-40330717 GAAGGTGATCACACTGGGCATGG - Intergenic
973288836 4:48449395-48449417 GAGGGAAAGCACGCTGAGGGAGG - Intergenic
973681733 4:53327470-53327492 GCAGGTGAGCAGACTGAGAAGGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976104873 4:81605893-81605915 GGGGGTGTGGACGCTGAGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977677076 4:99759523-99759545 GAGGGGGAGGACACAGAGGCGGG - Intergenic
981105567 4:140876673-140876695 GAGGGTGAGCACATAGAAGATGG + Intronic
984893158 4:184511409-184511431 GTGGGTGAGAACACTGTGAAAGG + Intergenic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
987112432 5:14700580-14700602 GAGGGTGAGCACAGAGGGTATGG - Intergenic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
989520998 5:42399772-42399794 TAGTGTGAGCCCACTGAGAATGG - Intergenic
991130932 5:63121595-63121617 GAGGGTGAGAAAGCTTAGGATGG + Intergenic
992586326 5:78244032-78244054 GATAGTGAGCACAGTGAGAATGG + Intronic
995283812 5:110364325-110364347 GAGAGATAACACACTGAGGATGG - Intronic
997429918 5:133830469-133830491 GAGAGTGAGTACAGTGAGGCAGG - Intergenic
998527429 5:142855627-142855649 GAAGATGAAGACACTGAGGATGG - Intronic
999712339 5:154329661-154329683 GCGATTGAGCACACTGTGGACGG - Exonic
1001660002 5:173384139-173384161 GGGAGAGAGGACACTGAGGATGG - Intergenic
1001747668 5:174104180-174104202 GAAGGTGGGCAGACTGAGGCTGG + Intronic
1001781346 5:174371531-174371553 GGGTGTGAGCCCTCTGAGGAAGG + Intergenic
1002419017 5:179135890-179135912 CAGGGTGAGTACACAGAGGCCGG - Exonic
1003271458 6:4611385-4611407 CAGCATGAGCACACAGAGGAGGG - Intergenic
1003414086 6:5892683-5892705 TAGGCAGAGCACACTGAGGATGG + Intergenic
1003551628 6:7107009-7107031 GACGGCGAGCACACTCAGGGCGG + Intergenic
1003889739 6:10553451-10553473 GATGCTGAGCACATGGAGGAGGG + Intronic
1005804607 6:29462491-29462513 GAGGGTGACCACAGTGAGATGGG - Exonic
1005816350 6:29555865-29555887 GAGGGTGACCACCCTGGGCATGG - Exonic
1005818202 6:29574619-29574641 GAGGGTGACCACAGTGAGATGGG - Intronic
1005819839 6:29588666-29588688 GAGGGTGACCACAGTGAGATGGG - Exonic
1006051190 6:31345864-31345886 AAGTGTGAGCACACTCATGAAGG - Intronic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006276317 6:33007740-33007762 GAGGGAGAGGAGACTGGGGAGGG + Intronic
1006515773 6:34544839-34544861 GCGGATGAGCAAACTGAGGTGGG + Intronic
1007736668 6:43986366-43986388 GACTGTGAGCATGCTGAGGAAGG + Intergenic
1007985298 6:46201757-46201779 GAACGTGAGTACACTAAGGATGG - Intergenic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009421771 6:63471841-63471863 GAGGGTGGGGACCCTCAGGATGG + Intergenic
1014003983 6:116396361-116396383 GGGGCTGAGCACACTGAGTGGGG + Intronic
1015750889 6:136557790-136557812 GATGCTGTGCACACTGTGGAAGG - Exonic
1017034067 6:150251304-150251326 GAGGGGGAACACACCTAGGAGGG - Intergenic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1019588239 7:1816100-1816122 GAGGGTGAGCGAGCTGAGGAAGG + Exonic
1021214741 7:17901610-17901632 GAGGGAGAGCACAGTGATTATGG - Intronic
1021523876 7:21564928-21564950 CAGGATGAGGACACAGAGGAAGG - Intronic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024447887 7:49502868-49502890 GGGAGTGAGAAAACTGAGGATGG - Intergenic
1026012845 7:66650262-66650284 GTGGGTGACCAAAATGAGGAAGG + Intronic
1026806958 7:73434744-73434766 GAAGGTGAGCACAGTGAAGGCGG - Exonic
1029571651 7:101373716-101373738 AAGTGTGAGCACATAGAGGAGGG + Intronic
1029702179 7:102254447-102254469 GAGGGTGATGCCACTGTGGACGG - Exonic
1030199931 7:106892238-106892260 GAGGGTTATCACACAAAGGAAGG - Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1031122614 7:117738767-117738789 GAGGGTGAGGGCATTGAGGAAGG + Intronic
1032513757 7:132492158-132492180 CAGGGTGGGGACACTGAGGCAGG + Intronic
1032644642 7:133809329-133809351 GAGGATTGGCACAATGAGGATGG + Intronic
1033653018 7:143356234-143356256 CAGTGTGTGCACCCTGAGGACGG - Exonic
1034331564 7:150287580-150287602 GGCGCTGAGCACACTGTGGAAGG + Intronic
1034738990 7:153455998-153456020 GAGGTTGAGGAGGCTGAGGAAGG + Intergenic
1034919893 7:155071090-155071112 GAAGGTGCGTACACGGAGGATGG - Exonic
1037254739 8:16941133-16941155 GAGGGAGAGCACAGTGACTAGGG + Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1037878657 8:22561928-22561950 GTGGGTGAGCACAGTGGGGCGGG + Exonic
1040493529 8:47946613-47946635 GAGTGTGAGCAAGATGAGGAGGG - Intronic
1045296015 8:100872172-100872194 GAGGGTGAGCGCTCTGGAGAAGG - Intergenic
1045527235 8:102951378-102951400 GAGGGGGAGTAAATTGAGGAGGG + Intronic
1048365604 8:133735733-133735755 GCGGATGACCACACGGAGGATGG + Intergenic
1048448780 8:134513055-134513077 GTGGGTGATTACACAGAGGAAGG + Intronic
1049325847 8:142021061-142021083 GAGGGTGTGAACCCTGAGGCCGG - Intergenic
1049351984 8:142169559-142169581 GAGGGTGGGGACCTTGAGGAAGG - Intergenic
1049521875 8:143095450-143095472 GAGGGTGAGGAAAGCGAGGAAGG + Intergenic
1050642289 9:7680988-7681010 GGGGGTCAGCGCACTGAGGGAGG - Intergenic
1058896427 9:109404506-109404528 GAGGGTGGGGACACTTTGGAGGG - Exonic
1059441601 9:114310613-114310635 GAGGTTGTCCACACTGATGATGG - Exonic
1061014668 9:127974863-127974885 GAGGCTGAGCACACTGGAGAGGG - Intronic
1061590316 9:131593743-131593765 GAGCCTGAGCACAGTGCGGATGG - Intronic
1061799807 9:133107543-133107565 GATGGGGAGCAGACTGAGGCGGG - Intronic
1062115873 9:134808234-134808256 GAGGGTGTGCACATTGGGAAGGG - Intronic
1062348878 9:136129110-136129132 GAGGGTGGGTAAAGTGAGGAGGG + Intergenic
1062536241 9:137022260-137022282 CAGGCTGAGCATCCTGAGGATGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186816041 X:13239029-13239051 GAAAGTGGGCAGACTGAGGAGGG - Intergenic
1187419349 X:19121887-19121909 GGGGGTGAGCACGCCGGGGAAGG - Intronic
1188972405 X:36633563-36633585 GAGGGAGAGCACAGTGATTATGG - Intergenic
1190765580 X:53473196-53473218 GAGGTAGAGCAGACTGAGGTGGG + Intergenic
1190981343 X:55458952-55458974 GAGGGAGAGCACACAGAGGAGGG + Intergenic
1190987355 X:55514228-55514250 GAGGGAGAGCACACAGAGGAGGG - Intergenic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1192112853 X:68382994-68383016 GAGGGTCATCATACTAAGGATGG + Intronic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193525366 X:82581628-82581650 GAGGGTGAGCAAAATCAGGGTGG - Intergenic
1194708039 X:97200049-97200071 GAGAGTGAGCACAAGCAGGATGG + Intronic
1195210703 X:102651015-102651037 GAGGGTGAGCAGACTAGGGAGGG + Intergenic
1196280365 X:113817183-113817205 GAGGGTGAGGAGGCTGAGGTAGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197977730 X:132183127-132183149 GAGATTGAGCACAGTGAGAATGG - Intergenic
1199987483 X:152963064-152963086 GAGGGTGAGCAGACTTAAGTTGG + Intronic
1200074484 X:153544349-153544371 GAAGGTGAGCAGCCTGAGAAGGG - Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201583215 Y:15532704-15532726 GAGGCTGAGGAGGCTGAGGAGGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic