ID: 904845424

View in Genome Browser
Species Human (GRCh38)
Location 1:33409974-33409996
Sequence CCTCATGTATTTTCTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904845420_904845424 5 Left 904845420 1:33409946-33409968 CCCAAAGGGGAAACTATTACTAT 0: 1
1: 0
2: 1
3: 16
4: 198
Right 904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG 0: 1
1: 0
2: 1
3: 32
4: 235
904845421_904845424 4 Left 904845421 1:33409947-33409969 CCAAAGGGGAAACTATTACTATA 0: 1
1: 0
2: 0
3: 11
4: 164
Right 904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG 0: 1
1: 0
2: 1
3: 32
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904845424 Original CRISPR CCTCATGTATTTTCTCTGGA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
903820964 1:26102285-26102307 CCTCATGGACTTTCTCTGGGAGG - Intergenic
904732103 1:32601565-32601587 TCTCATGTATTTTCTCAGTGAGG + Exonic
904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG + Intronic
904987037 1:34560218-34560240 ACACATGTAATTTCTCTGGAAGG - Intergenic
905696552 1:39978847-39978869 ACATATGTATTTTCTCTGTAAGG - Intergenic
906170042 1:43717371-43717393 GCTCATGTATTTTTTCAGAAAGG - Intronic
907938550 1:59064996-59065018 CCTCCAGTATGTTTTCTGGAAGG - Intergenic
908101174 1:60792673-60792695 CTTCTTATTTTTTCTCTGGAGGG + Intergenic
909044162 1:70689177-70689199 CCTCTTGTTTTTTCTCTGCCTGG - Intergenic
909417661 1:75425809-75425831 CCTCTGGTATTTTCTGTGCAAGG - Intronic
912940017 1:114036573-114036595 CCACATCTCTGTTCTCTGGAAGG - Intergenic
912964741 1:114227812-114227834 CCCCAAGTATTTTCTCTAGGAGG - Intergenic
914237555 1:145825665-145825687 ATTCATGTATTCTTTCTGGAGGG - Intronic
914375956 1:147073772-147073794 CCTCAACAATTTTCTATGGAAGG + Intergenic
915503014 1:156332771-156332793 CCTAACGTATTTTCTCTGTAAGG - Intronic
918409735 1:184245865-184245887 TCACATGCATTTTCTCTTGATGG - Intergenic
920742277 1:208592424-208592446 ACACAGGTATTTTCTCTGTAAGG + Intergenic
921553416 1:216567532-216567554 CCTAATGTATTTTCATTGGGAGG + Intronic
923399636 1:233603848-233603870 CATCATTTATTCTGTCTGGAAGG - Intergenic
924105680 1:240646817-240646839 CCTAATGTAATATATCTGGAAGG - Intergenic
924111990 1:240709177-240709199 CTTCATGTATTTTCAGTTGATGG + Intergenic
924692660 1:246366477-246366499 GCCCAAGTATTTTCTCTGCAGGG - Intronic
1064884661 10:20097402-20097424 CCTCATTTATTTTCCATGGCTGG + Intronic
1066224399 10:33368227-33368249 CATCATGTTTTGTCTCTGGGTGG + Intergenic
1066392739 10:34991293-34991315 CCTCAAGTATTTTTTCTGCCTGG - Intergenic
1066488861 10:35874854-35874876 CATCATGCATTGTCTGTGGATGG - Intergenic
1067021220 10:42800011-42800033 CCTCCTGTATTTCCTGTGAATGG + Intronic
1068771909 10:60831128-60831150 CCTCTTTTTGTTTCTCTGGAAGG + Intergenic
1068869671 10:61929461-61929483 GTTCATGTTCTTTCTCTGGAGGG + Intronic
1069716563 10:70524881-70524903 CCTCAAGTATTTCCTTAGGAGGG + Intronic
1070248812 10:74755701-74755723 ACACATGTATTTTCTCCGGAAGG - Intergenic
1071440219 10:85683885-85683907 GCTCATCTATTTTCTCTCGCTGG + Intronic
1073745487 10:106463759-106463781 ACACACATATTTTCTCTGGAAGG + Intergenic
1074319241 10:112385999-112386021 CTTAATGTATTCTCTCTGAATGG + Intronic
1075801101 10:125153789-125153811 CCTGAGGAAGTTTCTCTGGAAGG - Intronic
1077089166 11:770674-770696 CCTCCTGCATGTTCTCTGGTAGG - Exonic
1079364672 11:19798973-19798995 CCTCATGCATTTCCTCTGAGCGG - Intronic
1079723647 11:23851023-23851045 ACTTATGTTTTCTCTCTGGAGGG - Intergenic
1080411182 11:32026530-32026552 CCTCATGGATTTTCTCTAGGTGG - Intronic
1083232229 11:61330182-61330204 CACCATGTATTTTCTCTTTAGGG - Intronic
1085749385 11:79147482-79147504 CCTCATGAATTTTCTGAGGTTGG + Intronic
1086209390 11:84300385-84300407 CCTTGTGTCTGTTCTCTGGAAGG - Intronic
1087481402 11:98705682-98705704 CCTCATATATTTGCTGTGGAGGG - Intergenic
1087976453 11:104554726-104554748 ACACATATATTTTCTCTGCAAGG - Intergenic
1088395269 11:109361232-109361254 CCCCATGTGTTTTCTTAGGACGG + Intergenic
1090602966 11:128391682-128391704 CCTAGTGTGTGTTCTCTGGAAGG - Intergenic
1091329021 11:134716003-134716025 CCTCGTGGCATTTCTCTGGAGGG + Intergenic
1093799323 12:23352915-23352937 CCTCATTTCTCTACTCTGGAGGG + Intergenic
1093845779 12:23969555-23969577 CCTCAGCTATTTTCTCTGTTTGG + Intergenic
1093943704 12:25084085-25084107 CCTAATGAATTTTCTCTTTAAGG - Intronic
1096145441 12:49275728-49275750 CCTCAACTATGTGCTCTGGATGG + Intergenic
1096399429 12:51292937-51292959 ATACATGTATTTTCTCTGGAAGG - Intronic
1097349220 12:58529391-58529413 ACACATGTATTTTCTCTGTAAGG - Intergenic
1097407909 12:59214149-59214171 CCTCTTGGAATTTGTCTGGATGG - Intergenic
1098212517 12:68181546-68181568 CCTCTTGTGTTTTCTCTCCATGG + Intergenic
1098506687 12:71260637-71260659 CTTCATTTATTTTCTCTTGCTGG - Intronic
1099743590 12:86672531-86672553 CCTCTTGTTTTTTCTTTGAATGG - Intronic
1100036555 12:90259151-90259173 CCTCAGGTAGTTTGTCTGAAAGG - Intergenic
1100519520 12:95360038-95360060 CCACGTGTATTTTTTCTGTAAGG - Intergenic
1100647908 12:96550860-96550882 CCTCATCTCTTGTCCCTGGATGG - Intronic
1104043090 12:125143338-125143360 GCTGGTGTGTTTTCTCTGGAGGG + Intergenic
1104160377 12:126173563-126173585 CCTCATGTGTTGTCTCTTGGGGG - Intergenic
1104693105 12:130841145-130841167 CTTCATTTTTTTTCTCTGGCAGG - Intergenic
1106062113 13:26303624-26303646 GTTCATGTATGTTCTCTGGCTGG - Intronic
1107158990 13:37203682-37203704 CCTCATGTCTTTTCTTTGGAAGG + Intergenic
1108647225 13:52442081-52442103 TCCCATGTAATTTCTCTGAATGG - Intronic
1109334476 13:60975450-60975472 TCTCATGTATTTACTCCAGAAGG + Intergenic
1112179563 13:97064627-97064649 ACACATGTATTTTCTCCAGAAGG - Intergenic
1115359045 14:32481334-32481356 CCATTTGTATTTGCTCTGGAAGG - Intronic
1115502740 14:34063902-34063924 CCTCCTGTATTGGTTCTGGAAGG + Intronic
1119986258 14:79141684-79141706 TCTCCTTTATTTTCTCAGGATGG - Intronic
1120349461 14:83334783-83334805 CCCCCATTATTTTCTCTGGAAGG + Intergenic
1120385302 14:83838396-83838418 CCTCATGAAACTTCTCTGGGAGG + Intergenic
1120994173 14:90402992-90403014 CCTGAGGTATTTTCTTTGAAAGG + Intronic
1121360968 14:93259289-93259311 ACTCATGTATTATCTCTGTATGG + Intronic
1121608752 14:95261086-95261108 ACACATGTATTTTCTCCGCAAGG + Intronic
1122034653 14:98938481-98938503 CCTCATGGCTTTTCTTTGGAGGG - Intergenic
1122436855 14:101706452-101706474 CCTCATGAATTTCCTCCTGAAGG - Intergenic
1124167658 15:27342548-27342570 CCACGTTTCTTTTCTCTGGAAGG - Intronic
1126765976 15:52011465-52011487 TAACATGTATTTTCTCTGTAGGG - Intronic
1127145362 15:56017779-56017801 ACCCATATATTTTCTCTGTAAGG + Intergenic
1127337802 15:58007018-58007040 ACACATGTATTTTCTCTGTAAGG - Intronic
1127423346 15:58830619-58830641 GCACATGTATTTTCTCTATAAGG + Intronic
1128725413 15:69984378-69984400 GGTCATATATTTTCTCTGAATGG - Intergenic
1129125179 15:73434114-73434136 ACACATGTATTTTCTCTATAAGG + Intergenic
1129432360 15:75509026-75509048 CCTCATGTGTTTTCTCCACAGGG - Exonic
1132462564 16:62691-62713 CCTCATGTGTTTGCTCAGGAAGG - Exonic
1132638268 16:964455-964477 CCTCAAGTATTTTTTCTTTAAGG + Intronic
1133663576 16:7942999-7943021 CCTCATATGTTTTCTGTGGAAGG + Intergenic
1135499679 16:22983508-22983530 CCTCATTTATTCTCTCTGCAAGG - Intergenic
1138737867 16:59272829-59272851 ACACATGTATTTTCTCAGTAAGG - Intergenic
1140343934 16:74193919-74193941 ACACACGTATTTTCTCTGTAAGG + Intergenic
1144088869 17:11835469-11835491 ACTCATAAATTTACTCTGGAAGG + Intronic
1144166705 17:12618626-12618648 ACACATGCATTTTCTCTGTAAGG - Intergenic
1147186904 17:38717839-38717861 CCTTAGGTGTTTTCTCTGGCTGG + Exonic
1147426764 17:40349502-40349524 CCTGAGGTCTTTTCCCTGGAAGG + Intronic
1148018082 17:44536594-44536616 CCTCATTTCCTTGCTCTGGAGGG + Intergenic
1149418740 17:56487779-56487801 GCTCAAGTATTATCTCTGTAAGG - Intronic
1150551731 17:66216847-66216869 CATGATGGATATTCTCTGGATGG - Exonic
1150707817 17:67503503-67503525 GCCCTTGTATTTTCTCTGTAGGG + Intronic
1150842456 17:68621642-68621664 CCTCATTTGTTCTTTCTGGATGG + Intergenic
1151434983 17:74089604-74089626 CCTCTTGGATTTTCCCAGGAAGG - Intergenic
1152536843 17:80955453-80955475 CCTCTTGATTTTTCTCTGAAAGG - Intronic
1153146761 18:2042042-2042064 CCCAATCTATTTTCTCTGTAAGG - Intergenic
1154013860 18:10598836-10598858 ACACACGTATTTTCTCTGTAAGG + Intergenic
1154285999 18:13057151-13057173 CCTCATGCAGTTGCTCCGGAGGG - Intronic
1155722535 18:29034915-29034937 CTTCATGTATTTTCTTTACATGG + Intergenic
1156531035 18:37815204-37815226 CCTGAAGTATTTTCTTTGAATGG - Intergenic
1157490388 18:48119821-48119843 CCTGTTTCATTTTCTCTGGAGGG - Intronic
926705158 2:15832025-15832047 GCACATGTATTTCCTCTGTAAGG + Intergenic
926802385 2:16670277-16670299 ACACATGTATTTTCTCTGTAAGG + Intergenic
928866639 2:35924714-35924736 CCTCATGAATTGGCTCTGGTTGG + Intergenic
929084285 2:38152943-38152965 ACACATGTATTTTCTCTGTAAGG - Intergenic
930016187 2:46972126-46972148 TGTCATGTCTTTTCTCTGCATGG + Intronic
931306135 2:61030551-61030573 ACACCTGTATTTTCTCTGTAAGG - Intronic
931615713 2:64154989-64155011 ACACATGTATTTTCTCTATAAGG + Intergenic
932132427 2:69200016-69200038 CCTCATATGTCTTTTCTGGATGG + Intronic
932201747 2:69834410-69834432 CCTCAAGTATTTTCCAAGGAAGG + Intronic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
934970241 2:98757596-98757618 CTTCATGTTTATTCTTTGGAAGG + Intergenic
935549475 2:104437202-104437224 GCTCAAGTATTCTCTGTGGAGGG + Intergenic
935808311 2:106770659-106770681 CCTCCAGTATCTTCCCTGGAGGG - Intergenic
936137556 2:109908706-109908728 CCTTATGTATTTTCTCGTTAAGG + Intergenic
936207141 2:110462779-110462801 CCTTATGTATTTTCTCGTTAAGG - Intronic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
938739457 2:134217506-134217528 CATGATGTATTTCCTCTTGACGG - Intronic
940998863 2:160180251-160180273 GCTCATTTATTTTCAGTGGATGG - Intronic
941067847 2:160923497-160923519 CCTTATGCATTATCTATGGATGG - Intergenic
945866990 2:215187203-215187225 GCACATACATTTTCTCTGGAAGG - Intergenic
946932732 2:224687074-224687096 ACACTTGTATTTTCTCTGGCAGG - Intergenic
948749882 2:240125465-240125487 CCTCATTGACTTTCTCTGGATGG + Intergenic
1170149659 20:13216481-13216503 CTTCATGTATTTTCTATGACTGG + Intergenic
1170395836 20:15924287-15924309 CCTAATTTATTTTCTCTCCAAGG - Intronic
1170825292 20:19789310-19789332 TCTCTTGTATTTTTTCTAGAAGG - Intergenic
1171373239 20:24675054-24675076 ACTCAGGTCTTCTCTCTGGAGGG + Intergenic
1172209978 20:33190544-33190566 CCTTGTGTATTTTCTGTGGGAGG - Intergenic
1172599502 20:36174020-36174042 GCTCCAGTATTTTTTCTGGAGGG + Intronic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1173613871 20:44390320-44390342 CCTCCTGTTGTCTCTCTGGAGGG - Intronic
1175717240 20:61263294-61263316 CCTCCGGTATTGTCTCTGGCTGG + Intronic
1177797662 21:25795511-25795533 CCTCACGTATTTTCTATCAATGG - Intergenic
1180746845 22:18095237-18095259 CCTCCTGCTCTTTCTCTGGAGGG - Exonic
1181403511 22:22666082-22666104 CTTCTTGTCTTTTCTCTGCAGGG + Intergenic
949259975 3:2094674-2094696 ACACATGTATTTTCTCTGTGAGG - Intergenic
952381644 3:32809921-32809943 CTTCATGTGGTCTCTCTGGAAGG + Intergenic
953482885 3:43267052-43267074 CCTCATCTACCTTCTCTGAATGG + Intergenic
953514460 3:43576589-43576611 CAACATCTATTTTCTCTGCAAGG + Intronic
954025903 3:47782636-47782658 TCTCATGTAATTTATGTGGAAGG - Intergenic
954999354 3:54912604-54912626 CCTCAAATATTTTCTCAGCAGGG + Intronic
955389747 3:58512641-58512663 CCTCTTCTGTGTTCTCTGGATGG + Intronic
956186180 3:66564519-66564541 ACACACGTATTTTCTCTGTAAGG + Intergenic
957544639 3:81621830-81621852 CCTCATTCACTTTCACTGGATGG + Intronic
957733433 3:84175059-84175081 TCTTATGTATTTTCTCTGAGTGG + Intergenic
958119993 3:89273827-89273849 TAACATGTATTTTCTCTGTAAGG + Intronic
958764651 3:98351694-98351716 CCTGATGTTTTTTCTTTGTAGGG - Intergenic
958885628 3:99723598-99723620 CCTTATGAAATTTCTCTGGCAGG + Intronic
959526871 3:107387336-107387358 TTGCATGTATTTTCTCAGGATGG - Intergenic
962183960 3:133238693-133238715 GCTCATGTATTTTGTCTTCATGG + Intronic
962360238 3:134735371-134735393 ACACATGTATTTTCTCTGTAAGG + Intronic
963417101 3:145010708-145010730 CCACCTGTATTTTCTCTCTAAGG - Intergenic
963488413 3:145966954-145966976 ACTTATTTATTTTCTCTTGAAGG + Intergenic
967023456 3:185543303-185543325 ACACATGTATTTTCTCTCTAAGG - Intronic
967226034 3:187291967-187291989 CCTCAGTTATTTTCTCTCAAGGG - Intronic
967741606 3:193009296-193009318 CCTCCTGTAGTTACTCTGGGAGG + Intergenic
968911073 4:3477260-3477282 CCTCCTCTCTTCTCTCTGGAGGG + Intronic
970124371 4:12792705-12792727 CCACATGTTTTTTCCCTGAAGGG + Intergenic
971074961 4:23137456-23137478 GAACATGTATTTTCTCTGTAAGG - Intergenic
973070118 4:45848204-45848226 CCTGAGGTATTTTCTCTGAAAGG - Intergenic
975278019 4:72525550-72525572 GCTCATTTTTTTTCTTTGGAGGG - Intronic
975724062 4:77275239-77275261 CCTCTTGAGTTTACTCTGGAAGG - Intronic
977230650 4:94448420-94448442 CCTCAGGTCTTTGGTCTGGATGG + Intergenic
978227747 4:106358374-106358396 CCTCTTCTATTTTTTCTGCATGG + Intergenic
978411229 4:108428343-108428365 CCTCATGTATTTTCCATTTAAGG + Intergenic
980106849 4:128596054-128596076 TCTCATGTTTTCTTTCTGGAAGG + Intergenic
981739983 4:147991403-147991425 CCTCATGTTTTTTCCCAGGAGGG + Intronic
982439196 4:155415253-155415275 CCTAATGTCTTTTCTCTTGGTGG + Intergenic
982723209 4:158880658-158880680 CCAGATTTCTTTTCTCTGGATGG + Intronic
983286228 4:165742915-165742937 CCTCATACATTCTCTTTGGATGG + Intergenic
983303166 4:165953437-165953459 CCTCAGCTATGTTCTCTTGACGG + Intronic
984924930 4:184798473-184798495 ACTCACATATTCTCTCTGGAGGG + Intronic
985196461 4:187435422-187435444 CCACATGTAGTTTCTCTGCTTGG - Intergenic
990502200 5:56407820-56407842 CCTGATGTCTTTCCTCTGAAAGG + Intergenic
991110626 5:62895992-62896014 CTTCATGGATTTACTTTGGATGG + Intergenic
991521875 5:67508573-67508595 CATCAAGTATTTTCTATGAAAGG + Intergenic
992863399 5:80934680-80934702 ACTCATCTATTTTCCCTGCAGGG - Intergenic
994058180 5:95443861-95443883 GCCCATGTAATATCTCTGGAAGG - Intronic
994421447 5:99530008-99530030 ATGCATGTATTTTCTCTGTAAGG - Intergenic
994485598 5:100384303-100384325 ATGCATGTATTTTCTCTGTAAGG + Intergenic
997168131 5:131684020-131684042 ACACATGTATTTTTTCTGTAAGG + Intronic
998371230 5:141662833-141662855 ACACATGTATTTTCTCTGTAAGG - Intronic
998480088 5:142455662-142455684 ACACATGTATTTTCTTTGCAAGG - Intergenic
998819577 5:146046481-146046503 CTGAATGTATTTACTCTGGATGG + Intronic
998822620 5:146070347-146070369 CCTCATGGTTTTTTTCTGGGAGG - Intronic
999204881 5:149840709-149840731 CCTGATGTGTTTTCTCTGTGGGG - Intronic
1000029904 5:157392894-157392916 CTTCATGTATTTGTTCAGGATGG - Exonic
1000977426 5:167780575-167780597 ACACATGTATTTCCTCTGTAAGG - Intronic
1001812406 5:174638998-174639020 CCACTTGCATTTTCTCTGGGAGG - Intergenic
1004064561 6:12230461-12230483 ACGCATGTATTTTCTCTGTAAGG + Intergenic
1004128442 6:12896821-12896843 CTTCTTGTATTTTTTTTGGAGGG + Intronic
1005548358 6:26891786-26891808 ATGCATGTATTTTCTCTGTAAGG + Intergenic
1005729183 6:28680052-28680074 CCACATTTATTTTCTCTGATTGG + Intergenic
1007461624 6:42023333-42023355 TCTAATGTATTTTCTCTGTAAGG - Intronic
1010999064 6:82567079-82567101 CCCCATGTATCTCCTTTGGAAGG - Intergenic
1011514984 6:88144374-88144396 GTACATGTATATTCTCTGGAAGG - Exonic
1012538365 6:100327604-100327626 CTTGATTTATTTTCTCTGGGAGG - Intergenic
1016533835 6:145089443-145089465 CCTAATGCATTTACTTTGGAAGG - Intergenic
1017480275 6:154846678-154846700 CATCAGGTATTTTATCTGGTTGG + Intronic
1017813898 6:158003101-158003123 TTTCTTGTATTTTCTCTGGCTGG + Intronic
1022584053 7:31588061-31588083 CATTGTGTATTTTATCTGGAAGG - Intronic
1024355617 7:48410868-48410890 CCTCATGTATTTTCTCCTGGCGG - Intronic
1027390897 7:77702541-77702563 CTTCATTTCTTTTCTCTGGGTGG + Intronic
1028084047 7:86615229-86615251 CCTAATGTTTTTTTTCTGGGAGG - Intergenic
1028117336 7:87014114-87014136 TAACATGTATTTTCTCTGTAAGG - Intronic
1028998256 7:97125961-97125983 CTTCATGGATTTACTTTGGATGG + Intronic
1030307141 7:108030394-108030416 CTTGATGTATTTTCTTTGGCAGG + Intronic
1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG + Intronic
1030514611 7:110524192-110524214 CCTCATGGCTTTCCTCTGAAGGG - Intergenic
1031269094 7:119622140-119622162 AGTCATGTAATTTCTCTGGCTGG + Intergenic
1031412817 7:121460033-121460055 CCTGTTGTATCTACTCTGGACGG + Intergenic
1032143503 7:129356834-129356856 CCCCATGGATTTTATGTGGAAGG - Intronic
1032995139 7:137436621-137436643 CCTCTTTTATAATCTCTGGAAGG - Intronic
1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG + Intergenic
1037187593 8:16082432-16082454 CATCATGTATTTTATCTTGCAGG + Intergenic
1037281229 8:17244881-17244903 CCTGATGGATTTTGGCTGGAGGG + Intronic
1037765417 8:21769502-21769524 CCTCATGTTTCTTATCTGTAAGG - Intronic
1039715886 8:40108697-40108719 ACTCATTTATTTTCTCAGTAGGG + Intergenic
1040534851 8:48300068-48300090 ACTTATGTTTTTTCTTTGGAGGG + Intergenic
1040676845 8:49760693-49760715 ACTCATCTCTTTTCTCTGCAAGG + Intergenic
1041184143 8:55281396-55281418 CCTCATGTATCTTATCCTGAAGG + Intronic
1041675608 8:60535814-60535836 CACCATGTATTGTCTCTTGATGG + Intronic
1042206971 8:66339220-66339242 TCTCATGGATTTTCTGTGAATGG - Intergenic
1042963739 8:74329363-74329385 AGTCATGTATTTTGTGTGGAAGG + Intronic
1043975209 8:86577732-86577754 ACACACATATTTTCTCTGGAAGG + Intronic
1045505647 8:102776703-102776725 CCTGGTGAACTTTCTCTGGATGG - Intergenic
1045703174 8:104890306-104890328 GCTCATGGAATTTCTCTGGCTGG + Intronic
1046428009 8:114081172-114081194 ACACATGTATTTTCTCTATAAGG + Intergenic
1046541157 8:115585646-115585668 CTCCATGTATATTCACTGGAGGG + Intronic
1046697965 8:117363524-117363546 TCTCAAATATTTTATCTGGAAGG + Intergenic
1047242372 8:123102923-123102945 ACACATGTATTTTCTCTGTAAGG - Intronic
1047650502 8:126915098-126915120 CTTCATATCTTTTCTCTGCAGGG - Intergenic
1047716626 8:127601744-127601766 CCTCATGAATTTGACCTGGATGG - Intergenic
1048002567 8:130391508-130391530 ACTGATATATTTTCTCTGGTTGG - Intronic
1048915622 8:139180170-139180192 CCTCATGTATTTTCTGTTCTGGG + Intergenic
1049119688 8:140723678-140723700 CCTCATGTTTTTTCCCAGAATGG + Intronic
1050691923 9:8237342-8237364 CCAGATGTATTTTCTCTTGATGG + Intergenic
1051759597 9:20447309-20447331 CTTCACTTAGTTTCTCTGGAAGG - Intronic
1052035494 9:23675850-23675872 CATTATTTATCTTCTCTGGATGG - Intergenic
1052316906 9:27124717-27124739 CCTCATGGGTTTTTTTTGGAGGG + Intronic
1054766035 9:69043338-69043360 ACACATGCATTTTCTCTGTAAGG - Intronic
1054852172 9:69858524-69858546 ACACATGTGTTTTCTCTGAAAGG - Intronic
1055200783 9:73658397-73658419 CCTCTTTTATTTTCTCATGATGG - Intergenic
1056081698 9:83101930-83101952 ACACATATATTTTCTCTGTAAGG + Intergenic
1056259260 9:84831608-84831630 CCTCACTTTCTTTCTCTGGATGG - Intronic
1059038013 9:110780512-110780534 CCTCATGTATTTCCTTAGAAGGG + Intronic
1186265247 X:7825548-7825570 AGACATGTATTTTCTCTGTAAGG - Intergenic
1186410173 X:9339897-9339919 TATCATGAATTTTCTCAGGAAGG - Intergenic
1188523098 X:31060145-31060167 CCTGATGTTCTTTCTCTGAAAGG + Intergenic
1188736237 X:33719934-33719956 TCTCATTTATTTTGACTGGAGGG - Intergenic
1189365744 X:40387188-40387210 TATCATGTATTTTCTCTGTAAGG + Intergenic
1190948778 X:55121930-55121952 CCTCACGTTCTTTGTCTGGAGGG - Intronic
1192927876 X:75775904-75775926 CCTCATGTACTAACTCTGGGGGG + Intergenic
1195717723 X:107833498-107833520 ACTCATGGATTTTCTATGAAGGG + Intronic
1196945744 X:120823783-120823805 CATCCTGTATATTCTCTGTAGGG + Intergenic
1197178953 X:123513425-123513447 TCTCTTCTATTTTCTCTGGTGGG + Intergenic
1197342067 X:125286929-125286951 CCTCATGTTGTTGCTCTGGAGGG + Intergenic
1198486255 X:137090385-137090407 GCTCATGTATTTTATTTGGAAGG + Intergenic
1199493105 X:148423058-148423080 CCCCATGTATCTTCTCGGGAAGG + Intergenic
1201491764 Y:14549463-14549485 CATCATTTCTTTCCTCTGGATGG + Intronic