ID: 904847475

View in Genome Browser
Species Human (GRCh38)
Location 1:33430948-33430970
Sequence GGGCGGGCGCGTGCGCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904847475_904847485 15 Left 904847475 1:33430948-33430970 CCCCAGCGCGCACGCGCCCGCCC 0: 1
1: 0
2: 7
3: 39
4: 322
Right 904847485 1:33430986-33431008 CTCCGCGCTCCTCCTCCACCTGG 0: 1
1: 0
2: 2
3: 34
4: 321
904847475_904847491 30 Left 904847475 1:33430948-33430970 CCCCAGCGCGCACGCGCCCGCCC 0: 1
1: 0
2: 7
3: 39
4: 322
Right 904847491 1:33431001-33431023 CCACCTGGCCGCTCTCTCCCGGG 0: 1
1: 0
2: 3
3: 29
4: 308
904847475_904847489 29 Left 904847475 1:33430948-33430970 CCCCAGCGCGCACGCGCCCGCCC 0: 1
1: 0
2: 7
3: 39
4: 322
Right 904847489 1:33431000-33431022 TCCACCTGGCCGCTCTCTCCCGG 0: 1
1: 0
2: 0
3: 21
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904847475 Original CRISPR GGGCGGGCGCGTGCGCGCTG GGG (reversed) Intronic
900091998 1:924650-924672 GGGCGGCCTCGTGCAGGCTGAGG - Intergenic
900092182 1:925316-925338 GGCCGGGTGCGAGCGCGCGGCGG + Intronic
900382555 1:2392034-2392056 GGGCGGGCGGGGCCGCGCTGAGG + Intronic
900898754 1:5502868-5502890 GGGCGGGGGCGGGAGCTCTGGGG + Intergenic
901703924 1:11059748-11059770 GGGCAGGCGCCTGCGGGCAGCGG + Intronic
901762508 1:11479903-11479925 GGGAGGGCGCGTGGGGGCTTGGG + Intronic
903223916 1:21884499-21884521 TGGCGGGCGGGTGAGCGCTGCGG - Intronic
903349865 1:22711054-22711076 GGGCGGGCGGGCGGGCGATGGGG + Intronic
903652458 1:24930206-24930228 GGGCGGCCGCGGGCGAGCTTCGG - Intronic
903674473 1:25055450-25055472 GGAGGGGCGGGTGGGCGCTGGGG - Intergenic
903795119 1:25922921-25922943 GCGCGGCCGCGTGCGCCCGGGGG - Intergenic
903855742 1:26336793-26336815 GGGCGGGCCCGGGCGAGCCGGGG - Intronic
904029972 1:27527852-27527874 GGGCGAGGGCCTGGGCGCTGCGG - Intergenic
904062989 1:27725932-27725954 GGGCGGACCCGGGCGGGCTGGGG - Intergenic
904074717 1:27831253-27831275 GGGCTGGCTCGAGCGCGCTCGGG - Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
905685056 1:39901928-39901950 GGGAGGGCGCGCGCGCGGGGGGG - Exonic
905868572 1:41390229-41390251 GGGCGGGGGTGTGTGCACTGTGG + Intergenic
912411566 1:109483929-109483951 GGGCGGGCGCGCGTCCGCGGCGG + Exonic
912717150 1:111990497-111990519 GGGCCGGCGTGTGCGCGCGTGGG + Intergenic
912831303 1:112956234-112956256 GGGCCGGAGCATGCGCGCAGGGG + Intronic
914393449 1:147242614-147242636 GGGCGCGCGACTGCGCGCTGGGG - Intronic
915463169 1:156081690-156081712 GGGCTGGGGCGTCTGCGCTGCGG + Exonic
915722166 1:157993549-157993571 GGGCGGGCGCGGGCGGGCGGGGG + Intronic
916143884 1:161723249-161723271 GGGCTGGGGCCTGCGAGCTGGGG + Intronic
917920032 1:179743471-179743493 GGCGGGGCGCGGGCGGGCTGAGG + Intronic
920045170 1:203128110-203128132 GGGCAGGTGCGGGCACGCTGGGG + Intronic
921357882 1:214303782-214303804 GGGCGGGGGCGTGCGCGGTGGGG - Intronic
923007957 1:230067207-230067229 GGCCGGCCGCGGGCGCGGTGGGG - Exonic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
924527466 1:244864620-244864642 GGCCGAGCGCGGGCGCGCTCCGG - Intergenic
1062874124 10:931582-931604 GGGCGGGCGCGAGCTGGCGGCGG + Exonic
1064086337 10:12349161-12349183 GGGCGGGCGGGGGTGCGCGGCGG - Intergenic
1064086536 10:12349774-12349796 GAGCGGCCGGGGGCGCGCTGGGG - Exonic
1065101586 10:22336503-22336525 GGGCGGGAGCGAGAGCCCTGTGG + Intergenic
1067293347 10:44959976-44959998 GGGAGGGACCCTGCGCGCTGCGG - Intronic
1069761830 10:70816315-70816337 GGGCGGGCGCGGGGCCGCGGTGG + Intronic
1069913498 10:71773523-71773545 GTGCGAGCGAGTGAGCGCTGCGG + Intronic
1070800680 10:79243026-79243048 GGGAGGGCGCGCGCGAGCCGGGG + Intronic
1074618348 10:115093045-115093067 GGGTGGGCGCGCGCGCGTGGGGG + Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1075054496 10:119207499-119207521 GGGCCGGCGCTTGCGCAGTGCGG + Intergenic
1075940792 10:126388672-126388694 GGGCGGGGACGTGTGCGCTCCGG - Intergenic
1076371748 10:129959808-129959830 GCGCGGGCTCGGGCGCCCTGGGG - Intronic
1076404672 10:130203878-130203900 GGGCGGGCGGGGGCGGGCGGGGG - Intergenic
1076792759 10:132785735-132785757 GGGCCGGCCCGTGGGCGCGGCGG - Exonic
1076878960 10:133230804-133230826 GAGCCGGCGCGTGCGCGTTGGGG - Exonic
1077100363 11:819802-819824 GGAAGGGCGCGTGCTCGCGGAGG - Exonic
1077253855 11:1572083-1572105 GGGCCGGGGCGCGCGCACTGCGG + Intergenic
1077298848 11:1838116-1838138 GGGCGGGGGCCTGGGGGCTGGGG + Intergenic
1077322246 11:1947597-1947619 GGGCGGGCGTGGCCGGGCTGGGG + Intronic
1078222607 11:9364288-9364310 GGGCGGAAGCGGGCGCGTTGTGG + Intergenic
1079077790 11:17394645-17394667 GGGAGGGGGCGTGTGCACTGAGG + Intronic
1083758390 11:64803173-64803195 AGGCGGGCGGGCGCGAGCTGCGG + Exonic
1083845964 11:65333824-65333846 GTCCCGGCGCCTGCGCGCTGCGG + Exonic
1084112549 11:67023382-67023404 GCGCAGGTGCGTGCGCGCTGCGG + Intronic
1085295654 11:75430269-75430291 GGGCGTGCGGCTGCGCGCGGAGG - Exonic
1087141439 11:94768887-94768909 GCGCGGGCGCGGGCGCGCCTCGG - Intronic
1090788364 11:130069622-130069644 GCGCGGGGGCGTGCGCGCGGCGG - Intergenic
1202805264 11_KI270721v1_random:2910-2932 GGGCGGGCGTGGCCGGGCTGGGG + Intergenic
1091383586 12:78136-78158 GGGCGGGCGGCTGTGCGCGGGGG - Intronic
1091616201 12:2052922-2052944 GGGCGGGCGCGGGCGCGGCGGGG + Intronic
1091720930 12:2812945-2812967 GAGCGTGAGCATGCGCGCTGTGG + Intronic
1091823115 12:3491079-3491101 GGGCGGGCCCGGGGGCGCTGGGG + Intronic
1092169308 12:6363413-6363435 GGGCGGGCCCCTCGGCGCTGCGG + Intronic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1095180861 12:39145228-39145250 GGGCGCGCGCTTTCGCGCCGGGG - Intergenic
1096710628 12:53452625-53452647 GGGAGGGCGCGCGCGCGGTAGGG + Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1097180091 12:57166924-57166946 GGGGGGGCAGGTGCGGGCTGGGG - Exonic
1098369192 12:69739081-69739103 AGGCGGGCGCGCGGGCGCCGAGG - Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100839128 12:98594076-98594098 GGGCTGGCCCGTGGGCCCTGGGG - Exonic
1101354729 12:103966175-103966197 GGGGCCGCGCGTGCGCACTGTGG + Intronic
1101371943 12:104138299-104138321 GGGCGGGCGCGCGGGCGGCGCGG - Intergenic
1102839977 12:116108395-116108417 GGGGGGGCGCGTGGGGGGTGGGG + Intronic
1103410776 12:120710347-120710369 GGGCGGGGGCGGGCGCCCGGGGG - Intergenic
1103698494 12:122835438-122835460 GGGCGGGCCCGGGCGCGGCGCGG + Exonic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1105871884 13:24512689-24512711 AGGCAGGTGCGTGGGCGCTGCGG - Exonic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112507041 13:99981603-99981625 GCGCGCGCGGGTGCGCGCAGGGG + Intergenic
1113473214 13:110561534-110561556 GAGAGGGCGCGGGGGCGCTGGGG - Exonic
1113656010 13:112068129-112068151 GGGCGTGGGCGTGGGCGCGGCGG + Exonic
1114866284 14:26598323-26598345 AGGGGAGCGCGTGCGCGGTGAGG + Intergenic
1117038075 14:51747065-51747087 GGGCGGGCGCCTCCGCGATGCGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118206489 14:63728070-63728092 GGGCGGGGGCGCGCGGCCTGTGG - Intergenic
1119181027 14:72605349-72605371 AGGCGGGCGCTTGCACGCAGAGG + Intergenic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1121226144 14:92323290-92323312 GGGCGGCCGAGTGCGCGCCGCGG - Intronic
1122220968 14:100239031-100239053 GCGCGGGCGCGGGCGCACCGAGG + Exonic
1122418490 14:101561326-101561348 GGGCGGGCGCAGGCGGGCGGAGG - Intergenic
1122688615 14:103521485-103521507 GGGCGGGCGGGTCCGCGCTGCGG - Intronic
1122917335 14:104865214-104865236 GGGCGGGGGCGTGCCCGGGGCGG + Intergenic
1122930969 14:104932990-104933012 GGGAGGGCGCGTGCGGGGCGGGG - Exonic
1123684340 15:22786640-22786662 GGGCGGGCGCGGGCGGAATGGGG + Exonic
1124118187 15:26867116-26867138 GAGCGGGCGCGAGTGCGCCGGGG + Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1129334276 15:74843123-74843145 GCGCGGGCGCTTCCTCGCTGCGG + Exonic
1129351228 15:74956916-74956938 GCGTGGGAGCGGGCGCGCTGCGG + Exonic
1129540275 15:76342619-76342641 GGCTGGGCGCATGCGCGCTGAGG + Intergenic
1130321444 15:82845952-82845974 GGGCAGGCGCCTGCCTGCTGTGG - Intronic
1132055239 15:98647455-98647477 GCCGGGGCGCGTGCACGCTGCGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1133029622 16:3004274-3004296 GCGCGGGCGCGGGCGAGCCGCGG - Intergenic
1133188485 16:4116476-4116498 CGGGCCGCGCGTGCGCGCTGCGG - Intergenic
1136399833 16:30011251-30011273 GCACGGGCGTGTGCGCGCGGGGG - Intronic
1139365010 16:66427562-66427584 GGGCGGGCGGATGCGCGGTCCGG + Intronic
1141585398 16:85030118-85030140 GGGCGGGCGCAGGGGTGCTGCGG - Intronic
1141831097 16:86510367-86510389 GCGCGGGGGCGGGCGCGCCGCGG + Intergenic
1142199232 16:88753261-88753283 GGGGGGGCGGGTGAGCTCTGGGG - Intronic
1142672050 17:1491831-1491853 GGGCGCGCGCGTGTTCGCTGTGG - Intronic
1142810571 17:2393846-2393868 GGGAGGGCGCGCGTGCGCAGAGG - Intronic
1143223745 17:5282648-5282670 AGGCGGGGGCGCGCGGGCTGCGG + Intronic
1143491859 17:7289606-7289628 GGGCGGTTTCGTGGGCGCTGGGG + Exonic
1143503290 17:7351173-7351195 GGGTGGGAACGTGCGCGCCGCGG - Intronic
1143512608 17:7404791-7404813 GGGCAGGCGGGTGCGAGCGGGGG + Intergenic
1145750809 17:27353910-27353932 GAGCGGGCGCAGGCGCGGTGCGG + Intergenic
1145815653 17:27793477-27793499 GGGCGGGGATGTGCGCTCTGTGG - Intronic
1146922389 17:36722424-36722446 CGGCGAGCGCATGCGCGCTGGGG - Intergenic
1147015786 17:37490171-37490193 GGGCCGGCGAGGGTGCGCTGCGG - Intronic
1147134728 17:38428389-38428411 GGGCGGGGCCGAGCGCGGTGTGG - Intergenic
1147168680 17:38605987-38606009 GGGCGGGCGCGCGCGCGGCGCGG + Intergenic
1148225150 17:45894282-45894304 CGGAACGCGCGTGCGCGCTGCGG + Intergenic
1148284088 17:46372776-46372798 CGGCGGGGGCGCGCGCGCGGCGG + Intergenic
1148306309 17:46590697-46590719 CGGCGGGGGCGCGCGCGCGGCGG + Exonic
1148793188 17:50184986-50185008 GGGCGGGCAGGAGCGGGCTGAGG + Exonic
1151296914 17:73192845-73192867 GGGCGGGCGCGAGGGGGCGGGGG - Intronic
1151543324 17:74776478-74776500 GGGCCGGCGCATGCGCGCTGCGG + Exonic
1152581185 17:81166230-81166252 GGGCGGGAGCGCGCGCGGAGCGG + Intergenic
1154202335 18:12308187-12308209 GGGCGGGGGCGGGGGCGCGGAGG + Exonic
1157492975 18:48136883-48136905 GGGCGGCCGGGAGAGCGCTGCGG - Intronic
1160164299 18:76496152-76496174 GGGCGGGCGCGCGGGGGCGGGGG + Intronic
1160204516 18:76822321-76822343 GCGCGGGCGCGGGCGCGGTGGGG - Intergenic
1160726798 19:620984-621006 GGGAGGGCGCGGGGGCGCCGGGG + Intronic
1160776859 19:860586-860608 GGGCGGGCGCGTGAGGGCCGCGG - Intronic
1160824894 19:1074887-1074909 GGGCGGGCGGGGGCGGGCGGGGG + Intronic
1160824897 19:1074897-1074919 GGGCGGGCGGGGGCGGGCAGCGG + Intronic
1160864105 19:1249608-1249630 GGGCGGGGGCGGGCGCGGAGAGG + Intronic
1161051290 19:2165115-2165137 GGGCGCGTGCGTCCGCGCTTGGG + Intronic
1161080606 19:2308200-2308222 CGGCGGGCGGTTGCGCGCGGCGG - Intronic
1161155403 19:2730067-2730089 GGGCGGGGGCGAGCTGGCTGTGG - Intronic
1161203696 19:3029368-3029390 GGGGGGGCGCGGGCGCGGGGAGG - Intronic
1161241132 19:3224615-3224637 GGGCGGGCGCGGGCGGGAGGAGG + Intergenic
1161491834 19:4566619-4566641 GGGCTGGCGGGTGCGCCCCGTGG + Intergenic
1161494929 19:4581506-4581528 GGGCGGGAGGGCGCGGGCTGGGG + Intergenic
1161703055 19:5805306-5805328 GGGCGGCCGCGGGCGGGGTGCGG - Intergenic
1161707238 19:5827853-5827875 CGGCGCGCGCGTGCGCGGTTGGG + Exonic
1162435234 19:10654302-10654324 GGGCGGGCAGGCGCGCGCCGGGG - Exonic
1162931963 19:13961978-13962000 GGGCGGGGGCGCGGGGGCTGGGG + Exonic
1163427081 19:17245695-17245717 GGGGCGGCGGGTGCGCGCCGGGG + Exonic
1163804128 19:19385920-19385942 GGGGGTGCGCGTGCGCGCGCCGG - Exonic
1164648138 19:29873750-29873772 GCGCGGGCGCGGGGGCGCGGGGG - Intergenic
1165349489 19:35268421-35268443 GGGCGGGCGCGCGCGAGCCCGGG - Intergenic
1166140185 19:40801178-40801200 GGGCGGTCGCGTGCTGGCCGAGG + Exonic
1166304194 19:41928393-41928415 GCGCGGGCGGGCGCGCGCCGGGG + Intronic
1166555831 19:43699452-43699474 AGGCGCGCGCGTGTGCGCTTGGG + Intergenic
1166660952 19:44647119-44647141 GGGCGTGCACTTGCACGCTGGGG - Intronic
1166831482 19:45642148-45642170 GGCCGGGCGCCTCCGCGCTTAGG - Exonic
1166944483 19:46388470-46388492 GGGCCGGCGGGTGTGGGCTGTGG + Intronic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1167349354 19:48965027-48965049 GGGCGGGAGGGTGGGGGCTGGGG - Intergenic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168312481 19:55467925-55467947 GGGCGGCCGCCTGCAGGCTGCGG + Intergenic
1168356130 19:55701053-55701075 GGGCTGGCGCGGGGGCCCTGAGG + Intronic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
1168455847 19:56507834-56507856 AGGCTGGCGCCTGCGCGATGGGG + Exonic
1168489409 19:56795541-56795563 TGGCTTGCGCGTGCGCTCTGCGG + Intronic
1168714125 19:58517263-58517285 GGGCAGGGGCGTGGGCGCAGAGG + Exonic
925405937 2:3605492-3605514 GGGCGGCCACGTGGGTGCTGAGG + Intronic
925607468 2:5673486-5673508 GGGGCGGGGCGTGGGCGCTGGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
927544515 2:23940697-23940719 GGGCGGTCGCCTGCCGGCTGGGG + Intronic
928094086 2:28393405-28393427 GGGCGGGAGGGCGCGCGCAGGGG + Exonic
929033711 2:37671805-37671827 GGCCGGGCGCGCGCGCGGGGGGG + Exonic
930096396 2:47570114-47570136 GCGGAGGCGCGGGCGCGCTGGGG - Exonic
930780740 2:55223428-55223450 TGGCGGGGGCGAGCGCGCTGTGG + Intronic
931515927 2:63050678-63050700 GGGAGGGCGGGGGCGCGCGGAGG + Intronic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
932343157 2:70979124-70979146 GGGCAGTCGCCTGCGCACTGAGG - Exonic
935011654 2:99141550-99141572 GGGCGTGCGCCTGCGCGGCGCGG - Exonic
935137643 2:100321775-100321797 GGGCGGCCTGGTGCGCGCCGTGG - Exonic
937221744 2:120346066-120346088 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
937951030 2:127388050-127388072 GGCCGGGCGCGCGCCCGCGGCGG - Intronic
938368792 2:130756145-130756167 GGGCCGGCGCTGGCGCGCAGGGG - Intronic
939153805 2:138501759-138501781 GCGAGGGCGCGTGCGCGCGGCGG - Intergenic
941905610 2:170714773-170714795 GGGCGGGTGCGTGTGCGGCGAGG + Intergenic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
942277636 2:174334728-174334750 GGGGGGGCGAGGGCGGGCTGGGG - Intergenic
944675948 2:202034250-202034272 CGCGGGGGGCGTGCGCGCTGCGG + Intergenic
946865700 2:224039413-224039435 GGCCGGGCGCGGGGACGCTGCGG - Intergenic
947745058 2:232503180-232503202 GGGCGGGGGCGGGAGCGCGGCGG - Intergenic
948046854 2:234951937-234951959 GGGCGGGGGCGGGGGCGCGGGGG - Intergenic
948609642 2:239158715-239158737 TGGAGGGCGGGTGCGCGGTGGGG - Intronic
949004404 2:241637173-241637195 GGGCGGGGGCGGGCCCGCTGCGG - Exonic
949018177 2:241725294-241725316 GGGCGGGCGCGCGTGAGCTCGGG + Exonic
1170026075 20:11891019-11891041 GGGCAGGGGCGCGCGCCCTGCGG + Intronic
1170226314 20:13995361-13995383 GCGCCTGCGCGTGCGCCCTGGGG + Exonic
1171223398 20:23421083-23421105 TGGAGGGCGCGTGCGGACTGAGG + Intronic
1172404437 20:34677094-34677116 GGGCGGGCGCGCGGGCGGGGAGG + Intergenic
1174775754 20:53341709-53341731 GGGCAGGGGGGTGCGGGCTGGGG + Intronic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179663426 21:42893065-42893087 CTGCGGGCGCCTGGGCGCTGTGG - Intronic
1179785814 21:43729060-43729082 GGGCGGGCGGGTGCGGGGTGGGG - Intronic
1180699660 22:17774399-17774421 GCGCGGGCGCGTCCGGGCCGAGG + Intronic
1180977187 22:19854899-19854921 CGGCGGCCGCGCGCACGCTGGGG - Exonic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182766244 22:32760184-32760206 GGGCGGGTGGGTGCTGGCTGGGG - Intronic
1183370180 22:37427652-37427674 GGGCGGGAGCGGGCTTGCTGCGG - Intergenic
1183665689 22:39244558-39244580 GGGCGGGAGCGTGTGCGCCCTGG + Exonic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1183702386 22:39457683-39457705 GGGCGGGCGCGGGCGCACTGGGG + Intronic
1183720129 22:39557763-39557785 GGGCGGGGGCGCGGGTGCTGCGG - Intergenic
1184362094 22:44024678-44024700 GTGCGGGCGCCTGCGCGGCGGGG + Intronic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1185384601 22:50526064-50526086 GGCCGGGCGCAGCCGCGCTGGGG - Exonic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
950438719 3:12994941-12994963 GGGCGGGAGCGCGCCCGCGGGGG + Intronic
951485297 3:23203271-23203293 GGGCGGGCGCGAGCGCGGCGGGG + Exonic
954437500 3:50503750-50503772 GGGTGGGCGCGTGGCCGCGGCGG - Intronic
957054649 3:75434761-75434783 GGGCAGACGCGTGCTCGGTGTGG - Intergenic
961754909 3:129121819-129121841 GGGCGGGCGGGGGCGGGCTGGGG - Intronic
963827539 3:149971051-149971073 GGGCGGCCGAGCGCGCTCTGAGG - Exonic
965882033 3:173397728-173397750 GGGCGGGCGGGGGAGCGCCGCGG + Intronic
968321592 3:197773916-197773938 GGGCGTGTGCGTGAGTGCTGCGG - Intronic
968434141 4:576297-576319 GGGAGGGGGCGCGCGCCCTGCGG - Intergenic
968495685 4:914227-914249 GGGGGGGGCCGTGCACGCTGGGG - Intronic
968512930 4:1003264-1003286 GGCCGGGGGCGTTCGCCCTGAGG + Intronic
969053206 4:4386875-4386897 GGGCGGGCGCGTGGTCCCAGGGG + Exonic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
970394832 4:15655370-15655392 GGGCGGGCGCATGCGCAAGGGGG - Exonic
971196182 4:24472892-24472914 GGGCGGGCGTGTGCGCGCGGGGG + Intergenic
972396804 4:38664592-38664614 GGGGGGGCGCCTGCGGGCTTGGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978503647 4:109434122-109434144 GGACGGGAGCGGGCGCGGTGCGG + Intronic
978619338 4:110622972-110622994 GGGTGTGCGTGTGCGCGTTGCGG - Exonic
979455642 4:120922853-120922875 GGGCGCGGGCCTGGGCGCTGCGG + Intronic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
983076362 4:163331911-163331933 GGGGGTGGGCTTGCGCGCTGGGG + Intronic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
983940228 4:173529401-173529423 GGGCGGGCCCGGGCGCCCGGGGG - Exonic
984167437 4:176319869-176319891 GCGCCGCCCCGTGCGCGCTGTGG + Intergenic
985996472 5:3599968-3599990 CGGAGGGCCCGTGCGCGCCGGGG - Exonic
986330627 5:6713948-6713970 GGGCGGGCGCGCGGGCCCCGCGG + Intergenic
987050526 5:14143964-14143986 GGGCGGGCACCAGCGCGCGGTGG - Intronic
992105536 5:73447280-73447302 GGGCGAGCGCGCCAGCGCTGAGG + Exonic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992627432 5:78648464-78648486 CGTCGGGCCCGCGCGCGCTGCGG - Intronic
992939647 5:81750477-81750499 CGGCGGGGGCCTGGGCGCTGGGG - Intronic
993500501 5:88661009-88661031 GGGAGGCCGGGGGCGCGCTGCGG - Intergenic
994043543 5:95284443-95284465 CGGCGGGGGCGGGCGCGCTGGGG - Exonic
997521389 5:134526352-134526374 GGGCGGGCGGGGGCGCGCCAGGG + Intronic
997980611 5:138465580-138465602 GGGCGGGCGTGGACGCGCCGCGG - Exonic
998286930 5:140871283-140871305 CTGAGGGCGCGTGCGCGCCGGGG + Exonic
999129444 5:149271793-149271815 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
999232484 5:150069830-150069852 GGGCGGGCGGGGGGGCGGTGCGG + Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1001902722 5:175444733-175444755 TGGCGGGCGCGTCCCGGCTGCGG + Intergenic
1002163099 5:177328378-177328400 GGGCGGCCGTGTGCCCACTGCGG - Intergenic
1002204698 5:177554401-177554423 GGGCAGGCGCGAGCGGGCTCGGG - Exonic
1002455967 5:179345473-179345495 GGGCGGGCGGGGGAGCGCGGAGG + Intergenic
1002487612 5:179550523-179550545 GGGCGGGCGGGCGCGGGGTGGGG - Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1003086264 6:3063832-3063854 AGGCGCGCGCGTTCGCGCGGCGG - Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006912045 6:37569898-37569920 GTGCAGGAGCGTGCGAGCTGAGG - Intergenic
1007392944 6:41561029-41561051 GGGCGGGCGAGTGCGCAACGAGG - Intronic
1007626156 6:43247390-43247412 GAGCGGGGGCGTGAGGGCTGGGG + Intronic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1011277401 6:85643647-85643669 GGGCGGGCGGGAGCTCGGTGGGG - Intronic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012912895 6:105137208-105137230 GCGCATGCGCGTGCGCGGTGCGG - Intergenic
1016340917 6:143060812-143060834 GCGCGGGCGCGGGCGCGGGGCGG - Intronic
1017662418 6:156687422-156687444 GCGGGCGCGCGTGCGCGGTGCGG + Intergenic
1018125604 6:160679388-160679410 GGGCGGCCACGGGCCCGCTGCGG + Intergenic
1018150248 6:160931067-160931089 GGGCGGCCGCGGGCCCGCTGCGG - Intergenic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1018400222 6:163414321-163414343 GGGCGGGTGGGTGTGGGCTGCGG - Intronic
1018669696 6:166168173-166168195 GGGCGGGCTGGGGCGGGCTGGGG - Intronic
1018876528 6:167826872-167826894 GCGCGGGCGGGTGCGGGCGGCGG + Intergenic
1019109850 6:169701396-169701418 GGGCGGGAGCGTGGACCCTGAGG - Intronic
1019536142 7:1530865-1530887 CGGAGGGCGCGGGCGCGCGGCGG - Exonic
1019689616 7:2403465-2403487 GGCCGGGCGCAGGCGCGCTGAGG + Intergenic
1019711353 7:2519574-2519596 GGGCGTGCACGTGCGCGCCGGGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1023879504 7:44310071-44310093 GGGCGGGGGCGGGGGCGCTTTGG + Intronic
1023881799 7:44325144-44325166 GGGCAGGGCCGCGCGCGCTGAGG + Intronic
1023945122 7:44796898-44796920 GGGCGAGCGCGGGCGGGCTGCGG + Intronic
1023955728 7:44885378-44885400 GGGCGGGGGCGCGAGCGCGGCGG - Intergenic
1026000348 7:66556270-66556292 GCGCGGGCGCGGGCGCGAGGGGG - Intergenic
1026764830 7:73154100-73154122 GTCCGGGCGCGTGGGCCCTGGGG + Intergenic
1026850322 7:73719569-73719591 CGGCGGGCGGCCGCGCGCTGGGG + Intronic
1027082337 7:75238506-75238528 GTCCGGGCGCGTGGGCCCTGGGG - Intergenic
1029238699 7:99143676-99143698 GGGCGGGCGAGGGGGCGCCGGGG + Intronic
1029496062 7:100895928-100895950 GGGCGGGCGGGGGCGCTGTGAGG - Intronic
1029536992 7:101162942-101162964 GCGCCGGCGCGCGCGCGCGGCGG + Exonic
1029537695 7:101165725-101165747 CGGCCTGCGCCTGCGCGCTGGGG + Intergenic
1030820477 7:114086400-114086422 GGGCGTTCGCGGGCGGGCTGCGG - Intronic
1031043550 7:116862919-116862941 GGGCGGGGGCGCGGGCGCGGGGG + Intronic
1032122862 7:129169311-129169333 GGGCGGGCGCGTCCGGGGCGGGG + Intronic
1033186409 7:139231208-139231230 GAGCGGGCGCATGCGCACAGAGG - Intronic
1034911824 7:155003421-155003443 GGGGCGGCGCATGCGCGCGGCGG + Intergenic
1035262667 7:157671652-157671674 GGGCAGGGGCATGCGGGCTGGGG + Intronic
1035293030 7:157851851-157851873 GGGCAGGCGCGGGAGCGCTGAGG - Intronic
1037811470 8:22089391-22089413 GGGCGGGCGCGGGCCCCCTCGGG + Intronic
1038540213 8:28385479-28385501 GGGCGAGAGCGTGCGGGCAGAGG + Intronic
1038540504 8:28386339-28386361 GGGCGGGTGCGGGGGCGCGGAGG - Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039527941 8:38232399-38232421 GGGCGTGCGTGTGCGCACCGTGG + Intronic
1039864588 8:41490297-41490319 CGGCCGGCGCGAGCGCGCGGGGG - Intergenic
1041689885 8:60678650-60678672 GCGCGGGCGCGGGCGCGGCGCGG + Intergenic
1044591430 8:93917244-93917266 GGGCGGGCGTGGCGGCGCTGGGG + Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1045488599 8:102654082-102654104 GGGCGGGGGCGTGGGCGAGGAGG + Intronic
1047381978 8:124372445-124372467 GGGCGGGCGCCTCCCGGCTGAGG + Exonic
1049109760 8:140635538-140635560 GGGCGGCCGCGCGCGCGCCACGG + Exonic
1049222530 8:141434503-141434525 GGGTGGGAGGGTGCGGGCTGCGG + Intergenic
1049423792 8:142528364-142528386 GGCCTGGGGCGTGGGCGCTGTGG - Intronic
1049936562 9:505354-505376 GGGGAGGGGCGTGGGCGCTGCGG + Intronic
1053137122 9:35658294-35658316 TCGCGTGCGCGTGCGCGTTGGGG + Exonic
1056992280 9:91423555-91423577 GGGCGGGCGGGCGCGGGGTGCGG - Intronic
1058663104 9:107283719-107283741 GGGCAGCCGCGTGCGGGCCGCGG + Intronic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060106775 9:120877432-120877454 GGGCGGGCGGGGGCGGGCGGGGG - Intronic
1060355662 9:122905084-122905106 GGGCGGGGGCGGGCACGATGCGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1060832023 9:126722943-126722965 GGGCGGGGGCGGGCGCCCCGGGG - Intergenic
1061284748 9:129615692-129615714 GGGCTGGTGCGTGTGTGCTGGGG - Intronic
1061453492 9:130681582-130681604 GCGCGGGCGCGTGCGCGTGCGGG - Exonic
1061839174 9:133347836-133347858 GGGTGGGTGCGTAGGCGCTGGGG - Intronic
1061851383 9:133418012-133418034 GGACTGGAGCGTGCGTGCTGAGG - Exonic
1061900898 9:133671487-133671509 GGGCGGGGGCGGGCGCAGTGGGG - Intronic
1062365228 9:136205171-136205193 GGGCGGGCGCGCGGGCGGGGCGG - Intergenic
1062499701 9:136847084-136847106 GGGCCGGCGCGCGCGCGAGGTGG + Exonic
1062584215 9:137241685-137241707 GGGCGGGCCCGGGCGGGCCGGGG - Intronic
1062590609 9:137272898-137272920 GGGCAGGGGCGGGCACGCTGGGG - Exonic
1062618075 9:137407082-137407104 GGGCGGGCGGGGGCGGCCTGCGG + Intronic
1185504799 X:624229-624251 GGGCTGGCGCGCGCGCGCGAGGG + Intergenic
1186514715 X:10158521-10158543 GGGCGGCCGCGGGCGCGATGCGG + Exonic
1186768145 X:12791758-12791780 GCGCGGGCGCGGGGGCGCGGAGG - Intronic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1190861041 X:54344655-54344677 GGCCGGGCGCCTGGGCGCGGTGG + Intronic
1195158081 X:102142472-102142494 GGGCGGGCGGGCGGGCGCGGGGG + Exonic
1195308375 X:103607917-103607939 GGGCGGGCGGGCGGGCGCGGGGG - Intronic
1195954874 X:110318126-110318148 CGGCGGGGGCGAGCACGCTGCGG + Exonic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1198767157 X:140091567-140091589 GGGCGGGCGCGCGGGCGGCGGGG - Intergenic
1198808472 X:140511037-140511059 GGGAAAGCGCGCGCGCGCTGGGG - Intergenic
1200068814 X:153517909-153517931 GGGTGGGCGCGGGCGCGGCGCGG + Intronic
1200098186 X:153673857-153673879 TGGCGGGGGCGTGCGCGGAGGGG - Intronic
1200229436 X:154436839-154436861 GGGCGGGCGCGCGCGGGGCGGGG + Intergenic
1200240545 X:154490794-154490816 GCGCCGGCGCGGGCGCGGTGCGG + Intergenic
1201575343 Y:15456282-15456304 GCGCGTGCGCGTGCGCGAAGCGG - Intergenic