ID: 904847536

View in Genome Browser
Species Human (GRCh38)
Location 1:33431166-33431188
Sequence CACCCTAGAAGGGCGGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904847528_904847536 -6 Left 904847528 1:33431149-33431171 CCGCTCCAGCCAATGGTCACCCT 0: 1
1: 0
2: 3
3: 19
4: 203
Right 904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG 0: 1
1: 0
2: 0
3: 6
4: 100
904847524_904847536 27 Left 904847524 1:33431116-33431138 CCATATATTAGCATACCAGCGCG 0: 1
1: 0
2: 0
3: 0
4: 6
Right 904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG 0: 1
1: 0
2: 0
3: 6
4: 100
904847526_904847536 12 Left 904847526 1:33431131-33431153 CCAGCGCGCGTCACGTGGCCGCT 0: 1
1: 0
2: 1
3: 4
4: 42
Right 904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904847536 Original CRISPR CACCCTAGAAGGGCGGGGAT TGG Intergenic
902159742 1:14520324-14520346 CTCCCGAGAAGGGTGGGCATGGG + Intergenic
902749839 1:18499986-18500008 CACCAGAGAAGAGAGGGGATTGG + Intergenic
904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG + Intergenic
906493331 1:46285334-46285356 CACCCTGGAGTGGCAGGGATTGG - Intronic
907252032 1:53146037-53146059 CAGCCTGGGAAGGCGGGGATAGG + Intergenic
907303462 1:53501961-53501983 CACCCTAGAAGGGTGGAGGAAGG + Intergenic
907457556 1:54585275-54585297 CAGCCTGGTAGGGTGGGGATGGG + Intronic
922768087 1:228166270-228166292 CACCCGGGGAGGGCCGGGATGGG + Intronic
1063520786 10:6738751-6738773 CACTCTGTAAGGGCTGGGATAGG + Intergenic
1064027489 10:11860236-11860258 CACCCTAGAGGGGCTCGGGTAGG + Intronic
1067495298 10:46756147-46756169 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1067949016 10:50710827-50710849 GACCCTAGGAGGGTGGGGATTGG + Intergenic
1070676757 10:78417285-78417307 CTTCCTAGAAGGGCAGTGATGGG - Intergenic
1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1071983001 10:91022664-91022686 CACCCTAGCACTGCTGGGATGGG + Intergenic
1074366491 10:112861623-112861645 CAATCTAGTAGGGCAGGGATGGG - Intergenic
1075053284 10:119199114-119199136 TACCCTAGAAGGGCCAGGATGGG - Intergenic
1077324298 11:1957095-1957117 AACCCGAGAAGGGCCGGGAAGGG + Intronic
1078879682 11:15436006-15436028 CCCCATAGAAGGCAGGGGATGGG + Intergenic
1080574598 11:33586580-33586602 CACCTTAGAAGAGGGTGGATAGG + Intronic
1085888184 11:80545654-80545676 CACCCTAGAAGGGTGGTGAGAGG - Intergenic
1202807284 11_KI270721v1_random:12290-12312 AACCCGAGAAGGGCCGGGAAGGG + Intergenic
1096182714 12:49559420-49559442 AGCCTAAGAAGGGCGGGGATGGG + Intronic
1096262875 12:50103936-50103958 CACCCCTGGAGGGCGGGGCTTGG + Exonic
1101591423 12:106128743-106128765 TTCCCTGGAAGGGCGGGGAATGG - Intronic
1110462473 13:75760244-75760266 CAACCTTGGAGGGAGGGGATAGG + Intronic
1112616632 13:101013591-101013613 CACCCCAGCAGGGTGGGGTTGGG + Intergenic
1117439421 14:55745973-55745995 CACCCTACAGGGGTGGGGAGAGG - Intergenic
1118279486 14:64415473-64415495 CACCCGAGAAGGATGTGGATGGG + Exonic
1122267001 14:100551226-100551248 CACCCTAGCAGGGCCGGGCCGGG - Intronic
1122803563 14:104245170-104245192 CACCCTCTATGGGCAGGGATGGG - Intergenic
1124625392 15:31304654-31304676 CAAGCTGGAAGGGCTGGGATGGG + Intergenic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1133225872 16:4340130-4340152 CAGCCCAGAAGGGCCGGGCTGGG - Intronic
1137588125 16:49676666-49676688 CACCCTAGATGGGCATGGAAAGG + Intronic
1137765423 16:50974088-50974110 CACCCTAGGAGGGCAGAAATCGG - Intergenic
1138582852 16:57952912-57952934 CAACCTGGAAGGGGAGGGATTGG + Intronic
1141427069 16:83951626-83951648 CACCCTCGAGGGGCGGGGGATGG - Intronic
1148692009 17:49534170-49534192 CATCCTAGAAGAAAGGGGATGGG + Intergenic
1148743812 17:49907608-49907630 CATCCTGGAAGGGTGGGGGTGGG - Intergenic
1152805968 17:82356502-82356524 CACCCCAGGATGGTGGGGATGGG + Intergenic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1154023127 18:10682713-10682735 CACCCTCCAAGGGCAGGGAAGGG - Intronic
1157389438 18:47288872-47288894 CACCTTAGAAAGGTGGGGAGAGG - Intergenic
1158263950 18:55639560-55639582 CACCCTAGTAGAGAAGGGATGGG - Intronic
1158555934 18:58474845-58474867 CACCGTGGAAGGGCTGGGACAGG + Intergenic
1160968128 19:1755478-1755500 CACCCGAGAATGGCGGGGGAGGG + Intronic
1161728765 19:5946162-5946184 CTCCCGAGAGGGGCTGGGATAGG - Intronic
1162950885 19:14071833-14071855 CACCCCAGAATGGTGGGGTTGGG + Intergenic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1165062304 19:33210803-33210825 CAGACGAGGAGGGCGGGGATGGG + Exonic
1166262206 19:41648221-41648243 CAGCCTAGAAGGTCAGGGGTTGG + Intronic
1167376384 19:49114498-49114520 GACCCGGGAAGGGCGGGGACCGG - Intronic
1167798564 19:51726397-51726419 CACCCGAGCAGGGCGGGGTGGGG - Intergenic
932344786 2:70988446-70988468 CCCCCAAGGAGGGTGGGGATGGG + Exonic
937766038 2:125661582-125661604 CACCCTAGAAGGAAGGGTAAAGG + Intergenic
943343310 2:186707505-186707527 CAGCATAGAAGGGCAGGGTTGGG - Intronic
947996427 2:234531597-234531619 CAGACTAGAAGAGCTGGGATGGG + Intergenic
1172588521 20:36101619-36101641 AACCCTAGGAGGGAGGGGAATGG - Intronic
1173543167 20:43869642-43869664 CACCCAAGATGGGAGGGGACCGG + Intergenic
1180152726 21:45959978-45960000 CACCCTGGAAGGGCAGGGGCTGG - Intergenic
1183363436 22:37394782-37394804 CACCCTGTAAGGTCGGGGGTTGG - Intronic
951664244 3:25104375-25104397 CACTTTGGAAGGCCGGGGATGGG + Intergenic
953912884 3:46901710-46901732 CACCCTAGTGGGGCGGGGCAAGG - Intronic
954588893 3:51762994-51763016 CAGCCTAGAAGATGGGGGATGGG + Intergenic
954814507 3:53270136-53270158 CACCCTAGAAGGCCTGGGGCTGG + Intergenic
961495881 3:127290918-127290940 CACCCTAGACAGGATGGGATGGG - Intergenic
967838192 3:193981779-193981801 CAGCCTTGAAGGGCTGGGATTGG - Intergenic
968661648 4:1801146-1801168 CACCCTGGAGGGGAGGGGAGGGG + Intronic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
970387055 4:15566477-15566499 CCCCCTAGAAGGGAGGAGAAAGG + Intronic
972203846 4:36747733-36747755 CACCCTCAAGGGGCGGGGAAGGG + Intergenic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
978003541 4:103587399-103587421 CACACTAGAAGGGAGGTGCTCGG + Exonic
980874825 4:138651062-138651084 CTCCCCAGAAGGTAGGGGATAGG + Intergenic
989133457 5:38130187-38130209 AACCCTAGATGGGTGGGGGTGGG + Intergenic
992828068 5:80569429-80569451 CACCTGAGAAGGGCGGGAACCGG + Intronic
994506952 5:100655642-100655664 CACTCAAGAAGTGCGGGGACAGG - Intergenic
1000062127 5:157667152-157667174 CACCCAAGAAGTGGAGGGATGGG + Intronic
1006079721 6:31558318-31558340 CACCCCAGAGGAGCGGGGAGGGG + Exonic
1007154633 6:39730703-39730725 CACCTTATAATGGCGGGGGTGGG - Intergenic
1012550158 6:100458176-100458198 AACCCAAGGAGGGCGGGGTTCGG + Intronic
1016061691 6:139637145-139637167 CACCCTAGGTGGGCGAGCATCGG + Intergenic
1019260970 7:81834-81856 ATCCCTAGAAGGGAAGGGATGGG - Intergenic
1020036462 7:4966258-4966280 AACCCAAGAAGGGCGGGGCATGG + Intergenic
1020570202 7:9850813-9850835 CACCATGGAAGGGAGGGGAGTGG + Intergenic
1029506372 7:100966142-100966164 CACCCTAGAAGGAGGGGGCGGGG - Intronic
1032325439 7:130924194-130924216 CTCCCCAGCAGGGCAGGGATGGG + Intergenic
1036631369 8:10518195-10518217 CACCCTGGAAGGGCCAGGCTGGG + Intergenic
1036746759 8:11415386-11415408 ACCCTTAGAAGGGCGGGGACAGG - Intronic
1037603281 8:20416995-20417017 CACTCTGGAAGGGCAGGGACTGG - Intergenic
1037815633 8:22110193-22110215 CGCCCTGGGAGGGCGGGGGTGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039147379 8:34464014-34464036 CAGCCCAAAAGGGTGGGGATAGG + Intergenic
1049761270 8:144332954-144332976 CACCCTGGAGGGGAGGGGAGGGG + Exonic
1055013183 9:71589476-71589498 CACCCGCGAAGGACAGGGATTGG + Intergenic
1056574109 9:87842275-87842297 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1057209583 9:93192545-93192567 CACCCCAGGAGTGCAGGGATGGG + Intronic
1062483140 9:136761784-136761806 CACCTGGGAAGGGCGGGGGTGGG + Exonic
1188074255 X:25755741-25755763 CAACCTAGAAGGGCAAGTATTGG - Intergenic
1195316892 X:103687856-103687878 CAACCTTGAAGGGAGGGGGTAGG - Intronic
1195564079 X:106322130-106322152 GACCCCACAAGGGAGGGGATAGG + Intergenic
1195734906 X:108001741-108001763 CACCCTAGAAAGGCGGAGAAAGG + Intergenic
1197636648 X:128922126-128922148 CACCCTAGACCAGGGGGGATTGG + Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic