ID: 904851541

View in Genome Browser
Species Human (GRCh38)
Location 1:33463245-33463267
Sequence ACTGAGGCCCAGACAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904851541_904851548 22 Left 904851541 1:33463245-33463267 CCTTCTTCTGTCTGGGCCTCAGT No data
Right 904851548 1:33463290-33463312 GTTGGACTAGATGAACTCAGAGG No data
904851541_904851544 -2 Left 904851541 1:33463245-33463267 CCTTCTTCTGTCTGGGCCTCAGT No data
Right 904851544 1:33463266-33463288 GTTTTCCCATATGAAAAGGAAGG No data
904851541_904851543 -6 Left 904851541 1:33463245-33463267 CCTTCTTCTGTCTGGGCCTCAGT No data
Right 904851543 1:33463262-33463284 CTCAGTTTTCCCATATGAAAAGG No data
904851541_904851547 4 Left 904851541 1:33463245-33463267 CCTTCTTCTGTCTGGGCCTCAGT No data
Right 904851547 1:33463272-33463294 CCATATGAAAAGGAAGGCGTTGG No data
904851541_904851549 23 Left 904851541 1:33463245-33463267 CCTTCTTCTGTCTGGGCCTCAGT No data
Right 904851549 1:33463291-33463313 TTGGACTAGATGAACTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904851541 Original CRISPR ACTGAGGCCCAGACAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr