ID: 904851641

View in Genome Browser
Species Human (GRCh38)
Location 1:33463953-33463975
Sequence CCCTTCACAACTCCTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904851641_904851649 24 Left 904851641 1:33463953-33463975 CCTCCCAGAGGAGTTGTGAAGGG No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data
904851641_904851646 -5 Left 904851641 1:33463953-33463975 CCTCCCAGAGGAGTTGTGAAGGG No data
Right 904851646 1:33463971-33463993 AAGGGGTGAAGACAAACTAGAGG No data
904851641_904851647 -4 Left 904851641 1:33463953-33463975 CCTCCCAGAGGAGTTGTGAAGGG No data
Right 904851647 1:33463972-33463994 AGGGGTGAAGACAAACTAGAGGG No data
904851641_904851648 8 Left 904851641 1:33463953-33463975 CCTCCCAGAGGAGTTGTGAAGGG No data
Right 904851648 1:33463984-33464006 AAACTAGAGGGTTATACTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904851641 Original CRISPR CCCTTCACAACTCCTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr