ID: 904851645

View in Genome Browser
Species Human (GRCh38)
Location 1:33463957-33463979
Sequence TCACCCCTTCACAACTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904851645_904851649 20 Left 904851645 1:33463957-33463979 CCAGAGGAGTTGTGAAGGGGTGA No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data
904851645_904851648 4 Left 904851645 1:33463957-33463979 CCAGAGGAGTTGTGAAGGGGTGA No data
Right 904851648 1:33463984-33464006 AAACTAGAGGGTTATACTAACGG No data
904851645_904851646 -9 Left 904851645 1:33463957-33463979 CCAGAGGAGTTGTGAAGGGGTGA No data
Right 904851646 1:33463971-33463993 AAGGGGTGAAGACAAACTAGAGG No data
904851645_904851647 -8 Left 904851645 1:33463957-33463979 CCAGAGGAGTTGTGAAGGGGTGA No data
Right 904851647 1:33463972-33463994 AGGGGTGAAGACAAACTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904851645 Original CRISPR TCACCCCTTCACAACTCCTC TGG (reversed) Intergenic
No off target data available for this crispr