ID: 904851649

View in Genome Browser
Species Human (GRCh38)
Location 1:33464000-33464022
Sequence CTAACGGATGTCCCTTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904851644_904851649 21 Left 904851644 1:33463956-33463978 CCCAGAGGAGTTGTGAAGGGGTG No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data
904851645_904851649 20 Left 904851645 1:33463957-33463979 CCAGAGGAGTTGTGAAGGGGTGA No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data
904851639_904851649 30 Left 904851639 1:33463947-33463969 CCACTTCCTCCCAGAGGAGTTGT No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data
904851641_904851649 24 Left 904851641 1:33463953-33463975 CCTCCCAGAGGAGTTGTGAAGGG No data
Right 904851649 1:33464000-33464022 CTAACGGATGTCCCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904851649 Original CRISPR CTAACGGATGTCCCTTCACA TGG Intergenic
No off target data available for this crispr