ID: 904854177

View in Genome Browser
Species Human (GRCh38)
Location 1:33484063-33484085
Sequence ACTAATAAGCAGTTATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 4, 1: 39, 2: 98, 3: 160, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904854177 Original CRISPR ACTAATAAGCAGTTATAGCA AGG (reversed) Intronic
900107603 1:991082-991104 ACTAATAAACAGGTACAGCAAGG - Intergenic
900723024 1:4191150-4191172 ACAAATAAGCAATTATAACAAGG - Intergenic
901168979 1:7241073-7241095 ACTAATAAATAGGTTTAGCAAGG + Intronic
902127804 1:14231656-14231678 ACTGATAACCAGTTATTGCTAGG - Intergenic
904854177 1:33484063-33484085 ACTAATAAGCAGTTATAGCAAGG - Intronic
904967485 1:34387946-34387968 ACTAATAAGCAATTATAGCAAGG + Intergenic
904982165 1:34514969-34514991 ACTAATAAACAAGTTTAGCAAGG + Intergenic
905288299 1:36901861-36901883 ATTAATAAGCAATTATAGAAAGG + Intronic
906455346 1:45991726-45991748 ACTAATAAGCAATTACAACAAGG - Intronic
906742309 1:48194506-48194528 ATTGATAAGTAGTTATAGAAAGG + Intergenic
906833093 1:49055105-49055127 ACTAATAAGCTGTTATCCCAAGG - Intronic
906951620 1:50339349-50339371 ACTAATAAGCAATTTTAGCAAGG - Intergenic
907236376 1:53052964-53052986 TCTGATAAGCAGTCATAGCGAGG + Intergenic
907315248 1:53566366-53566388 ACTAATAAGCAATTATAGCAAGG + Intronic
907881979 1:58558408-58558430 ACTAATAAGCAATTAAAGCAAGG + Intergenic
908047858 1:60191079-60191101 ATTAATAAGCAATTATAGCAAGG + Intergenic
909375048 1:74930893-74930915 ATGAATAAGTAATTATAGCAAGG + Intergenic
909645336 1:77910771-77910793 ACTAATAAGTTATTTTAGCAGGG + Intronic
909944044 1:81643216-81643238 ACTAATAAGTGATTATAGCAGGG + Intronic
910161269 1:84275207-84275229 GCTAATAAGTAATTATAGGAAGG - Intergenic
910325835 1:86005844-86005866 ATGAATAAGCAGTTATAGCAAGG + Intronic
910946926 1:92603349-92603371 ACTCAAAAGAAGTTAAAGCAGGG + Intronic
911343168 1:96664056-96664078 ATTAATAAGCAATTATAGCAAGG - Intergenic
911806600 1:102217335-102217357 ACTAATAAGTGATTACAGCAAGG + Intergenic
911813179 1:102310356-102310378 AGTAATAAGCAATTATTGTAAGG + Intergenic
911934762 1:103955371-103955393 GCTAATAAGCAGTTATAGAAAGG - Intergenic
912131123 1:106601748-106601770 ACTAATAAGCAATGATATAAAGG + Intergenic
912136842 1:106670675-106670697 ACTAAAAAGTCATTATAGCAAGG + Intergenic
912479348 1:109968030-109968052 AACAATAAGTAATTATAGCAAGG + Intergenic
913028144 1:114867619-114867641 ACTAATAAGCAATTACAGCAAGG - Intronic
913092540 1:115488567-115488589 ACTAATAAGTGGTTGTAGCAAGG + Intergenic
916602856 1:166310734-166310756 ACTAATAAAAGATTATAGCAAGG - Intergenic
916805489 1:168256196-168256218 ACTAGTAAGCAATTATAGTAAGG - Intergenic
917172740 1:172195286-172195308 ACTAACAAGTAATTAAAGCAAGG - Intronic
917319801 1:173768700-173768722 ACTACTAAACAGTTAAAACATGG + Intronic
917363925 1:174208234-174208256 ACTAATAAGCAAGTACAGTAAGG - Intronic
917568585 1:176238076-176238098 ACTAATAAGTGATTATAGCAAGG - Intergenic
917586113 1:176427758-176427780 ACTTATAAGGAATTATAGTAAGG - Intergenic
917763051 1:178185203-178185225 ACCAAAAAGCAGTTATAGCAAGG - Intronic
917907933 1:179607288-179607310 ACTAATTAGCAATTATAGCAAGG - Intronic
918351891 1:183664746-183664768 TATAATAAGCAATTACAGCAAGG - Intronic
918539849 1:185619174-185619196 ACTAATAAGAAATTATAGCAAGG + Intergenic
918948352 1:191100319-191100341 AATAATAAGCAAATATAGAAAGG + Intergenic
918969830 1:191399037-191399059 ATTAATAAGCAATTATAGCAAGG + Intergenic
921093356 1:211864136-211864158 TCTAATAAACAATTATAGCAAGG - Intergenic
921485538 1:215711639-215711661 ACTAATAAGAATTCTTAGCAAGG - Intronic
921605492 1:217148733-217148755 TCTAATAAGCAATTATAGCAAGG + Intergenic
922181459 1:223237209-223237231 ACTAATAAGCAATTATAGCAAGG - Intronic
923023092 1:230180967-230180989 ACTAATAAACAATTACAGCAAGG - Intronic
923709122 1:236371284-236371306 ACGAATAAACAATTACAGCAAGG - Intronic
923759025 1:236822696-236822718 ACTAACAAGCAATTATACCAAGG - Intronic
923981671 1:239331047-239331069 ACCAATAAGCACTTGCAGCAAGG + Intergenic
1063297634 10:4823261-4823283 ACTACTAAGCAATTATAGCAAGG + Intronic
1063637214 10:7794232-7794254 ACCAATAAGCATTTATGACAAGG - Intronic
1063807487 10:9662446-9662468 ACTAATAAGCAAATATAGCGAGG - Intergenic
1063843501 10:10099640-10099662 ACTAATAAGTGTTTATGGCAAGG + Intergenic
1063843529 10:10100144-10100166 ACTAATAAGTGTTTATGGCAAGG + Intergenic
1063973882 10:11400270-11400292 ACTAACAAACAGTAAGAGCATGG + Intergenic
1064036853 10:11920988-11921010 ACTACTGAGCAGTTACACCAAGG - Exonic
1065203974 10:23340958-23340980 ATTAATAAGCATTTGTAGGATGG - Intronic
1065243322 10:23730853-23730875 ACTAACAAGCAATTATAGCAAGG - Intronic
1065277696 10:24102172-24102194 ATGAAGAAGCAATTATAGCAAGG + Intronic
1065469140 10:26059047-26059069 ATGAATAAGCAATTACAGCAAGG - Intronic
1065521053 10:26573171-26573193 ACTAACAAGCAGTTATAGCAAGG - Intergenic
1065526476 10:26626825-26626847 ACTAATAAGCAGTTACAGCAAGG - Intergenic
1065530065 10:26660446-26660468 ACTAATAAGCAGTTATAGCAAGG - Intergenic
1065619241 10:27562618-27562640 ACTAATAAGAAATTATAGCAAGG - Intergenic
1065934212 10:30506233-30506255 ACTAAAAAGTAGTTATTGCTGGG + Intergenic
1066043136 10:31571912-31571934 ACTACTAAGCAATGATAGCAAGG + Intergenic
1066485649 10:35841185-35841207 ACTAATAAGTGATTATAGCCAGG - Intergenic
1066999108 10:42589665-42589687 ATTAATAAGCAATTATAGCAGGG - Exonic
1067320344 10:45213785-45213807 ACTAATAAACAACTACAGCAAGG + Intergenic
1067347746 10:45449226-45449248 ACTAATAAGTGGTTACAGTAAGG + Intergenic
1067514294 10:46924051-46924073 CTTAATAAGCAATTACAGCAAGG - Intronic
1067647963 10:48127758-48127780 CTTAATAAGCAATTACAGCAAGG + Intergenic
1068154201 10:53175349-53175371 ACTAATAAGTGATTATAGCAAGG + Intergenic
1068825255 10:61430595-61430617 ACTAGTAAACGTTTATAGCAAGG + Intronic
1069541885 10:69300903-69300925 ACTAATAAACAATTTCAGCAAGG + Intronic
1069586722 10:69610284-69610306 AATAATAAGCCATTATAGCAAGG + Intergenic
1070187690 10:74081820-74081842 ACTAAGAAGGAGGAATAGCAGGG + Intronic
1070245479 10:74727589-74727611 ACTAATAGGCAAGTTTAGCAAGG + Intergenic
1070852475 10:79577351-79577373 ATTACTAAACAGTTATGGCAAGG + Intergenic
1071998405 10:91169412-91169434 ACTAATAAGCAATTACAGCAGGG + Intronic
1072509819 10:96109400-96109422 ACTAATAAGTGATTAGAGCAAGG - Intergenic
1073639141 10:105231375-105231397 ACTAATACATAATTATAGCAAGG - Intronic
1074629685 10:115238587-115238609 ACTAATAAGCTAGCATAGCAAGG - Intronic
1074653918 10:115560016-115560038 ACTAATACACAATTTTAGCAAGG + Intronic
1074804685 10:117037039-117037061 ACTAATAAGCATTTATAGCAAGG + Intronic
1075267568 10:121016175-121016197 ACTAATAAGTAGTTATAGCAAGG + Intergenic
1075570808 10:123542207-123542229 ACTAATAAGTTATTTTAGCAAGG - Intergenic
1076575910 10:131467608-131467630 ACTACTAAGTGATTATAGCAAGG - Intergenic
1076622494 10:131800855-131800877 ACTAATAAGAAGTTTCAGCAAGG + Intergenic
1076635245 10:131877559-131877581 ATTAATAAGTGATTATAGCAAGG + Intergenic
1076991077 11:274872-274894 ACTAATAAGTGATTATAGCAAGG - Intergenic
1077380298 11:2232693-2232715 ACTAAAAAGCAACTATGGCAAGG + Intergenic
1077780256 11:5319986-5320008 ACTGATAAACAATTTTAGCAAGG + Intronic
1077817472 11:5699986-5700008 ACTAATAAGTAATTATAGCAAGG - Intronic
1078168287 11:8909948-8909970 ACTAATTAGCAGTGAGAGCCTGG + Intronic
1078403777 11:11050005-11050027 ACTAATAAGCATATTCAGCAAGG - Intergenic
1078880264 11:15441224-15441246 ACTAAAAAACAGTTAAAACAAGG - Intergenic
1079688317 11:23390603-23390625 ACTAATCAGAACTTATTGCAAGG - Intergenic
1081624285 11:44638674-44638696 ACTAATAAACAAATTTAGCAAGG + Intergenic
1081642822 11:44768460-44768482 ACAAATAAGCAATTATACTAAGG - Intronic
1081880753 11:46449315-46449337 ACTATTAAATAATTATAGCAAGG + Intronic
1084015760 11:66379968-66379990 AATAATAAGCAATTATACCAAGG - Intergenic
1084339427 11:68485243-68485265 ACTTATAAGCCATTATACCAAGG - Intronic
1084644841 11:70450355-70450377 ATTAATAAGCAATTATACCAAGG - Intergenic
1085753291 11:79181730-79181752 ACTAATAAGCAATTATAGCAAGG + Intronic
1085915911 11:80887419-80887441 ACTATAAAGCAGTGAGAGCAAGG - Intergenic
1086037052 11:82428654-82428676 ACTAATAAGCAACCATAGCAAGG + Intergenic
1086172702 11:83854008-83854030 ACTAATAAGCAATTAGAGCAAGG + Intronic
1086187979 11:84042388-84042410 ATTAATGAGCAATAATAGCAAGG - Intronic
1086363370 11:86082547-86082569 ACTAATAAGCTATTATAACAAGG - Intergenic
1086678300 11:89637173-89637195 ATTATTAAGAATTTATAGCAGGG + Intergenic
1087417744 11:97879511-97879533 ATTAATAAGCAAATATAACAAGG + Intergenic
1087979859 11:104598198-104598220 ACTAATAAGAAATGATAGCAAGG + Intergenic
1088430248 11:109750765-109750787 ACTGATAAGTATTTATGGCATGG + Intergenic
1088445307 11:109920519-109920541 AGTAATAAGCAGCTAGAGCAAGG - Intergenic
1088733371 11:112704018-112704040 ACTGATAAACAATTTTAGCATGG + Intergenic
1088929636 11:114338240-114338262 ACTAATAAACAATTATAACAAGG + Intergenic
1088948831 11:114543863-114543885 ACTACTAAGTAAATATAGCAAGG + Intronic
1089062945 11:115641188-115641210 ACTTATAAGAATTGATAGCAGGG + Intergenic
1089628473 11:119767954-119767976 ACTAATAAGCAAGTTTAGCAAGG - Intergenic
1089910581 11:122095978-122096000 ACTAATTAGCATTTATTGCCTGG + Intergenic
1090030192 11:123199690-123199712 ACCAATAAGCAATTACAACATGG + Intergenic
1090552212 11:127833822-127833844 ACCAATAAGCAATTCTAGCAAGG + Intergenic
1091081776 11:132677029-132677051 ACTAATAAGCAATTATAGCAAGG + Intronic
1091438338 12:492251-492273 ACTAATAAGCAAGTATAGAAGGG + Intronic
1091454282 12:594229-594251 ACTAATAAGCAAGTATTACAAGG + Intronic
1091462504 12:655396-655418 ACTAATAAGCAATTATAGCAAGG + Intronic
1093357555 12:18186770-18186792 ACTAATAAGTGACTATAGCAAGG - Intronic
1093616305 12:21229726-21229748 ACTAATAAGCAATTATTGCAAGG - Intronic
1093900819 12:24629956-24629978 ACTAATAAGCAATTATATTAAGG - Intergenic
1093903323 12:24661252-24661274 AATAATGAGCAGTAATAGCCAGG - Intergenic
1093903347 12:24661385-24661407 AATAATTAGCAGTAATAGCCAGG - Intergenic
1094274940 12:28663105-28663127 ACTAATAAACAATTATAGCAAGG + Intergenic
1094314656 12:29125741-29125763 ACTAATAAGCAATTATAACAAGG - Intergenic
1094394210 12:29988115-29988137 ACTCAAAAGTAATTATAGCAAGG - Intergenic
1094595876 12:31865902-31865924 ACTAATAAATAATTTTAGCAAGG + Intergenic
1094645442 12:32318995-32319017 ACTAATAAGCAAGTATAGCAAGG - Intronic
1095460587 12:42440346-42440368 ACTAATATGTGATTATAGCATGG - Intronic
1095835546 12:46634828-46634850 ATTAATAAGTGATTATAGCAAGG - Intergenic
1096039835 12:48504820-48504842 ACTAACAAGCAATTATTGCAAGG + Intergenic
1096395879 12:51266310-51266332 TCTACTAAGCGTTTATAGCATGG - Intronic
1097455468 12:59793720-59793742 ACTAATAATCAATTATAGCAAGG - Intergenic
1097611016 12:61820410-61820432 TCTAATAAGCAGTAATAGTGTGG + Intronic
1099571957 12:84333301-84333323 ACCAATAATCAGTTAAATCAAGG + Intergenic
1100017804 12:90032979-90033001 ACTAATAAACAATTAGAGCATGG - Intergenic
1100030500 12:90183527-90183549 ACTAATAAGCTGTTATAGCAAGG + Intergenic
1100705446 12:97195643-97195665 GCTTGTGAGCAGTTATAGCAAGG + Intergenic
1101624739 12:106428338-106428360 TGTAATAAGCAGTTCTATCAGGG - Intronic
1102577571 12:113865971-113865993 ACAAATAAGGAGTTTCAGCATGG + Intronic
1102735955 12:115159662-115159684 ACGAAGAAACAGTGATAGCAAGG - Intergenic
1105670179 13:22604856-22604878 ACCAATAAGCAATTATTGCAAGG + Intergenic
1105671397 13:22620488-22620510 ACTAATAGGCAATTACAGCAAGG - Intergenic
1105726334 13:23165904-23165926 ACTAATGAGCAATTATAGCAGGG - Intergenic
1106063098 13:26314708-26314730 ACTACAAAGCAGGTAAAGCATGG - Intronic
1106771660 13:32967150-32967172 AATAATAAACACTTATAGCAAGG - Intergenic
1107257312 13:38443786-38443808 ACTAATAAGCTATCACAGCAAGG - Intergenic
1107808246 13:44174903-44174925 AATAATCAGCAGTGATAGCCAGG - Intergenic
1108065764 13:46576219-46576241 ACTCAAAGGCAGTTTTAGCAAGG + Intronic
1108998163 13:56761963-56761985 ACCAGTAATCAATTATAGCAGGG + Intergenic
1109548400 13:63860017-63860039 AGTCATAAGCAGCTACAGCAAGG + Intergenic
1109632630 13:65071638-65071660 ATTAATAAGCAATTATAGCAAGG + Intergenic
1110346595 13:74455039-74455061 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1110909282 13:80935006-80935028 ACTAATAAGGGATCATAGCAAGG - Intergenic
1111129156 13:83952161-83952183 AATAATAAGCAATTACAGTAAGG + Intergenic
1111313430 13:86519050-86519072 ACTAATAAACAATTTTACCAAGG + Intergenic
1111429363 13:88132124-88132146 ACTAATAAGCAATTACGGCAAGG + Intergenic
1111481862 13:88839615-88839637 AATAATGAGTAATTATAGCAAGG + Intergenic
1111689715 13:91548245-91548267 ACTAATAATCAATTATGGCAAGG + Intronic
1112070960 13:95849891-95849913 ACCAATAAGGGATTATAGCAAGG - Intronic
1112263422 13:97899624-97899646 TCTAATAAACAGTTATAGCTTGG - Intergenic
1112535473 13:100249923-100249945 ACTGATAAGCAATTATAGTAAGG - Intronic
1112959716 13:105108476-105108498 ACTAATAAGTAATTATAATAGGG + Intergenic
1113971151 13:114190429-114190451 AGGAATAAACAATTATAGCAAGG + Intergenic
1114515663 14:23298281-23298303 CCTAATAAGAGATTATAGCAAGG + Exonic
1115064992 14:29248086-29248108 ACTAACAAACAATTTTAGCAAGG - Intergenic
1115639868 14:35327546-35327568 ACTACTAAGCATTTATAGGACGG + Intergenic
1115678336 14:35707204-35707226 ACTAATAAGCAATTATAGCAAGG - Intronic
1115817939 14:37182971-37182993 ACTAATAAGTTATCATAGCAAGG + Intergenic
1116217524 14:42037716-42037738 AATAATAAGCAGTTTTTTCAAGG + Intergenic
1116504206 14:45658696-45658718 ACAAATAAGCAATCATAGCAAGG - Intergenic
1116642156 14:47477921-47477943 ACTAATTAGCTGTTTTGGCATGG - Intronic
1116665764 14:47772904-47772926 GCTAATAAGCAATTATAGCAAGG + Intergenic
1116834459 14:49756763-49756785 ACTAATAAGCAATTATAGCAAGG - Intergenic
1118131624 14:62971145-62971167 ACTCATAAGTAATTATAGCAAGG + Intronic
1118268439 14:64318129-64318151 ACTAATAAACAATTACAGCAAGG + Intronic
1118428235 14:65691063-65691085 ACTAATAAGTAACTATATCAAGG - Intronic
1119078252 14:71666543-71666565 AGTAATAAGTAGTCATAACAAGG + Intronic
1119277877 14:73376182-73376204 ATTAATAAGCAATTATAGCAAGG + Intronic
1119534210 14:75388472-75388494 ATTATTTAGCAATTATAGCAAGG + Intergenic
1120236821 14:81902095-81902117 ACTTAAAAGTAGTTCTAGCAAGG - Intergenic
1120272687 14:82334699-82334721 ACTAACAATCAGTTACAGCAAGG + Intergenic
1120837217 14:89051587-89051609 ACTAATCAGCAATTACAGCAAGG + Intergenic
1122360500 14:101158384-101158406 CATAATAAGCAATTATAGCAAGG - Intergenic
1202942083 14_KI270725v1_random:159757-159779 AATAATAAGCATTTACAGCATGG + Intergenic
1123795989 15:23770669-23770691 ACTAATAGGCAAATATAACAAGG - Intergenic
1123969821 15:25496930-25496952 ACTAATAAGCAATTATAACAAGG + Intergenic
1124708249 15:31983343-31983365 ACTAAGGAGCAGCTATACCAAGG + Intergenic
1125135663 15:36338509-36338531 ATTAATAAGCAATTATAGCAAGG - Intergenic
1126291345 15:47083683-47083705 AATAATAAGCATTTACAGCATGG - Intergenic
1126346465 15:47699909-47699931 ACTAATAAGCAATTATAACAAGG + Intronic
1127150545 15:56070261-56070283 ATTAATAAGCAACTCTAGCAAGG + Intergenic
1128598892 15:68978559-68978581 ACTAATAAGCAAGTGTAGTAAGG - Intronic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1129142866 15:73617239-73617261 ACTAAAAAGCAGGAATATCAAGG + Intronic
1129308245 15:74684740-74684762 ACTAATAAGGAAATTTAGCAAGG + Intronic
1129374314 15:75118555-75118577 ACTAATAAGCAAATGTAGCAGGG - Intergenic
1129575755 15:76743428-76743450 ACTGATAAGCTGTTCTGGCAAGG + Intronic
1131919291 15:97305527-97305549 ACTAATAGGCAATTATAGCAAGG - Intergenic
1132022912 15:98379620-98379642 ACTAATAAGCAATATTAGCAAGG + Intergenic
1134321074 16:13163842-13163864 ACTAATAAGTGATTTTAGCAAGG - Intronic
1135433861 16:22411549-22411571 ACTAATAAGCAATTATAACAAGG - Intronic
1136284396 16:29232666-29232688 CCTATTAACCAGTTATAACAAGG + Intergenic
1137473454 16:48784289-48784311 ACTAATAAGTAATTATGACAAGG - Intergenic
1138278558 16:55754994-55755016 ACTAAAAACCACTTATAGAATGG + Intergenic
1138289996 16:55838627-55838649 ACTAAAAACCACTTATAGAATGG - Intergenic
1138906170 16:61337379-61337401 ACTAATAAACAATTTTAGTAAGG + Intergenic
1139049390 16:63104698-63104720 ATTTGTAAGCAGTTACAGCAAGG - Intergenic
1139184127 16:64784447-64784469 ACTAATAAACAATTGTAGCAAGG - Intergenic
1139309177 16:66013845-66013867 TCTTATAAGTAATTATAGCAGGG + Intergenic
1140243131 16:73222349-73222371 ACTAATAAGTGATTATAGCAAGG + Intergenic
1140616955 16:76676647-76676669 AGCAATAAGCAATTATAGAAAGG + Intergenic
1140623483 16:76764384-76764406 ACTAATAAGCAGTTATAGCAAGG + Intergenic
1142089430 16:88202178-88202200 ACTATTAACCAGTTATAACAAGG + Intergenic
1143558941 17:7680441-7680463 ACTAATAAATAAATATAGCAGGG - Intronic
1144466384 17:15500846-15500868 AATAATAAGCATATATTGCATGG - Intronic
1145048649 17:19640699-19640721 ACTAATAAGTGATTATAGCATGG + Intergenic
1146474281 17:33150493-33150515 ACTAATAATCACTTATTCCAAGG + Intronic
1146996518 17:37325533-37325555 AGTAAAAAGTAGTTATAGCTTGG - Intronic
1149106764 17:52977231-52977253 GCTAGTAAGCAGGTATAGCAAGG - Intergenic
1149194754 17:54106143-54106165 ACTGATAAACGATTATAGCAAGG + Intergenic
1149929339 17:60735181-60735203 ATTGATAAGCAATTACAGCAAGG - Intronic
1153751369 18:8234442-8234464 ACTAATAAGCAAATGTAGCAAGG - Intronic
1153766026 18:8375972-8375994 ACAAATAAGCAGGGATAGCTGGG - Intronic
1154232202 18:12567101-12567123 ACTAATAAGCAATTATAGCAAGG + Intronic
1155593165 18:27452148-27452170 ACTATTAAGGAATTGTAGCAAGG - Intergenic
1155904502 18:31433333-31433355 ACTAATAAGCAATTACAGGAAGG + Intergenic
1156089742 18:33452538-33452560 ACTAATAAATTATTATAGCAAGG + Intergenic
1156594500 18:38532591-38532613 ACTAATAAACAATTATAGCAAGG - Intergenic
1156652819 18:39246016-39246038 ACTTTTAAGCAATTATAGCAAGG + Intergenic
1159296054 18:66490296-66490318 ACAAATAAGAAAGTATAGCAAGG + Intergenic
1160173612 18:76574760-76574782 ACTAATAAGTGATTATAGCAAGG + Intergenic
1163240001 19:16055925-16055947 ACTAATAAACAATTTTAGCAAGG - Intergenic
1164253567 19:23507271-23507293 CCTAATAAGCAGTTATCTCCTGG + Intergenic
1164275153 19:23710597-23710619 ACAAATAAGCAGTTAAGGCCGGG + Intergenic
1164665611 19:30032585-30032607 ACTTATAAGTGATTATAGCAAGG - Intergenic
1164701526 19:30287983-30288005 TCTAATGATCAGTTATAACAAGG + Intronic
1164815513 19:31198559-31198581 ACTAATAAATAATTATACCAAGG + Intergenic
1165284023 19:34823662-34823684 ACTAATAAGTGATTATAGTAAGG + Intergenic
1167805010 19:51775776-51775798 AGTAATAAGTGATTATAGCAGGG - Intronic
1168008515 19:53510796-53510818 ACACATAAGAAGTTACAGCATGG - Intergenic
925701445 2:6642685-6642707 ACTAATAAGCAATTATAGCAAGG + Intergenic
926835961 2:17020881-17020903 ACTAATAAATGATTATAGCAAGG - Intergenic
927266218 2:21154390-21154412 ACAAATAATCAGTTATATTAAGG + Intergenic
927673485 2:25088616-25088638 GCTATAAAGCACTTATAGCAGGG - Intronic
928006375 2:27565780-27565802 AGTAATAAGCAGTGAGAGTAGGG - Intronic
928050106 2:27983815-27983837 ACTAATAAACAGCTTCAGCAAGG - Intronic
928159801 2:28911923-28911945 ACTTATAAGAAGTAACAGCAGGG - Intronic
928369077 2:30726509-30726531 ACTAATAAACAAGTTTAGCAAGG + Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
928862470 2:35875194-35875216 AATAACAAGCAGTGATACCAAGG - Intergenic
928892959 2:36226690-36226712 ACTAATACACAATTATAGCCAGG + Intergenic
929421764 2:41798103-41798125 ACTAATAAGGGATTATAGCAAGG - Intergenic
929508719 2:42549905-42549927 ACTAATGAGCAGGTACAGCCTGG - Intronic
929767806 2:44863742-44863764 ACTAATAAGAGATGATAGCAAGG + Intergenic
930242238 2:48947965-48947987 TCTAATAAGAAGATATAGAATGG - Intergenic
930591950 2:53338301-53338323 ACTAATAAACAAGTTTAGCAAGG - Intergenic
930854946 2:56005008-56005030 GGAAATAAGCAATTATAGCACGG - Intergenic
930909098 2:56609005-56609027 ACTAATAAGCAATTGTAGCAAGG - Intergenic
930940657 2:57010548-57010570 ACTGATAAGTGATTATAGCAAGG + Intergenic
930959715 2:57246074-57246096 ACTATTAAGTTATTATAGCAAGG - Intergenic
931389604 2:61830111-61830133 ATTAATAAGCCTTTATAACAGGG - Intronic
932027203 2:68146634-68146656 ATTATTAAGGAGTTAAAGCAAGG + Intronic
932470854 2:71955430-71955452 ACTAATTAGCAATTATAGCAAGG - Intergenic
933210618 2:79564367-79564389 ACTAATACGCAGTTATATCATGG - Intronic
933223709 2:79720739-79720761 ACTGATAAACAGGTTTAGCAAGG - Intronic
933571005 2:84012038-84012060 AATAATAAGCACTTATAGCAAGG + Intergenic
933872745 2:86585196-86585218 GCTAATAAGCAATTATAACAAGG + Intronic
935540824 2:104346644-104346666 ACTAATAAGTATGTTTAGCAAGG + Intergenic
937109262 2:119350109-119350131 ACTAATGAGCAGTTAAAGGGAGG + Intronic
937542672 2:122978162-122978184 ACTAGTAAGCAACTATAGCAAGG + Intergenic
937805255 2:126134061-126134083 ACTAGTAAGTGATTATAGCAAGG - Intergenic
937843336 2:126549879-126549901 AGTAATAAGCAATTATCGCAAGG + Intergenic
938719089 2:134049302-134049324 ACTAATGGGTAATTATAGCAAGG + Intergenic
938970846 2:136430852-136430874 ATTAATAAGCAATTATGGCAAGG - Intergenic
939910030 2:147969991-147970013 ATTGAGAAGCAATTATAGCAAGG + Intronic
940163806 2:150744964-150744986 ACCAATAAGCAATTATGGCAAGG + Intergenic
940179118 2:150912569-150912591 ACTACTAGGGAGTTATAGGAAGG - Intergenic
940313137 2:152300290-152300312 ACTAATAAGTAATTATATCAAGG - Intergenic
940410169 2:153353312-153353334 ACTAATAAGAGATTATAGCAAGG - Intergenic
940879003 2:158927436-158927458 ACTAGTAAGCAATTATAGCAAGG - Intergenic
941212506 2:162658832-162658854 ACTAATAAGCAATTATAGTAAGG - Intronic
941587228 2:167375701-167375723 ACTGATAAACACTTTTAGCAAGG - Intergenic
943194851 2:184732886-184732908 ACTAATAGGCAATTACAGCAAGG - Intronic
943224772 2:185157721-185157743 TTAAATAAGCAGTTATAACAAGG - Intergenic
943485261 2:188471684-188471706 AATAATAAAAAGTTAAAGCAGGG - Intronic
943710433 2:191088198-191088220 ACTAATAAGCCATTAGAGTAAGG + Intronic
944028979 2:195209523-195209545 ACTAATAAGTGATTATAGCAAGG - Intergenic
945021500 2:205577151-205577173 ATTAATAAGCAATTATAGCAAGG - Intronic
945153811 2:206816406-206816428 ACTAATAAACTATTATAGCAAGG - Intergenic
945327853 2:208503635-208503657 ACTAATAAGTGGTTATAGTAAGG - Intronic
946913761 2:224493566-224493588 GCTAATAAGCAGTTATTAGATGG - Intronic
946967976 2:225058815-225058837 AGCAATAAGTAATTATAGCAAGG - Intergenic
1169534784 20:6526042-6526064 AGTCATAAGCAGATAGAGCAAGG - Intergenic
1169643838 20:7786963-7786985 ACTAATAAACAACTATAGCAAGG + Intergenic
1169801959 20:9519732-9519754 ACTCAAAAGCATTTATGGCAGGG - Intronic
1170636562 20:18110455-18110477 ACTAAGAAGCAATTTTAACAAGG - Intergenic
1170646907 20:18205167-18205189 ATTAATAAGTGATTATAGCAAGG + Intergenic
1170772462 20:19345109-19345131 ACTAATAAGTAATTATAACAAGG + Intronic
1171384508 20:24760922-24760944 ACTAATAAGCAATTACAGCAAGG + Intergenic
1171467894 20:25344322-25344344 ACTAATTAGTGATTATAGCAAGG + Intronic
1171538004 20:25914919-25914941 AATAATAAGCATTTACAGCATGG + Intergenic
1171803144 20:29646530-29646552 AATAATAAGCATTTACAGCATGG - Intergenic
1171840936 20:30210218-30210240 AATAATAAGCATTTACAGCACGG + Intergenic
1172616648 20:36291854-36291876 ATTAATAAGCAATTATAGCAAGG - Intergenic
1172866526 20:38103618-38103640 ACTAATAAGCAAGTTCAGCAAGG + Intronic
1173418457 20:42879616-42879638 ACACATGAGCAGTTAGAGCAAGG + Intronic
1173680622 20:44878057-44878079 ACTAGTAAGAAATAATAGCAAGG + Intergenic
1175519841 20:59594293-59594315 ACTAATAAATTATTATAGCAAGG - Intronic
1176581087 21:8527173-8527195 AATAATAAGCATTTACAGCATGG - Intergenic
1177221286 21:18196235-18196257 TCTAATAAGCTCTTATAACATGG + Intronic
1177348611 21:19904489-19904511 ACTAATAAGTGATTATAGCAAGG - Intergenic
1177621240 21:23597345-23597367 ACTAATAAGTAATTATAGCAAGG + Intergenic
1178399467 21:32272911-32272933 ACTAATTAGCAGTAAGAGCTAGG - Intronic
1178624586 21:34204242-34204264 ACCAACAAGCATTTATTGCAGGG + Intergenic
1178758970 21:35382233-35382255 ACTGATAAGCACTTTAAGCATGG - Intronic
1181505649 22:23354859-23354881 ACTATAAAGCACTTATAGAATGG + Intergenic
1182824277 22:33250381-33250403 ACTAATAAGCAATTAGAGCAAGG - Intronic
1183614061 22:38931684-38931706 ACTAATAAGCAATTATATAAAGG - Intergenic
1184945465 22:47800528-47800550 ATTAATAAGCAATTATAGCAAGG + Intergenic
1184969833 22:48009655-48009677 ACTAATAAGCAATTATAGCAAGG - Intergenic
949196089 3:1309994-1310016 ACTAATAAGTGCTTATAGCAAGG - Intronic
951437002 3:22676557-22676579 AATAATCAGCAGTAGTAGCAAGG - Intergenic
951676861 3:25250724-25250746 AGTCCTAAGCAGCTATAGCAAGG - Intronic
951821804 3:26822125-26822147 CCTAATAAGCAGATATAGCTAGG - Intergenic
952442947 3:33351297-33351319 ACTAATTAGCAATTATAGTAAGG + Intronic
952635958 3:35531512-35531534 ACTAATAAGCATTTATAGCAAGG + Intergenic
952640272 3:35585654-35585676 ACTAATAGGCAATTGTAGCAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953640957 3:44707191-44707213 ACAAAAAAGCAGTCATAACAAGG + Intergenic
953732652 3:45463580-45463602 ACTAGTAATAAGTAATAGCATGG + Intronic
953873818 3:46652380-46652402 ACTACTAAGCAATTATAGCAAGG + Intergenic
954087221 3:48254828-48254850 ACTAATAAGCAAACATAGAAAGG - Intronic
954530855 3:51318915-51318937 ACTAATAAGTAAATTTAGCAAGG - Intronic
954879850 3:53826871-53826893 ACTAATAAGCAATTATAGCAAGG + Intronic
954893004 3:53948821-53948843 ACTAATAAACAAATATAGTAAGG + Intergenic
955951560 3:64247807-64247829 TTTAATTAGGAGTTATAGCATGG + Intronic
957331885 3:78776055-78776077 AAAAATAAGCAAATATAGCATGG - Intronic
957400450 3:79706022-79706044 ACTAATAAGCAATTATAGGCAGG - Intronic
957594721 3:82248133-82248155 ACTAATAAGTAAGTTTAGCAAGG - Intergenic
958001719 3:87759054-87759076 ACAACTAAGCAATTATAGTAAGG + Intergenic
958443744 3:94189396-94189418 ACTAACAAGCAATTATAACAAGG - Intergenic
959046619 3:101481884-101481906 ACCAATAAGCAATTACAGCGAGG + Intronic
959168822 3:102818753-102818775 ACTAATGAACTATTATAGCAAGG - Intergenic
959300397 3:104592166-104592188 ACAAATAATCATTTAGAGCATGG - Intergenic
959524569 3:107362027-107362049 ACTAATAAGCAGAAATGGCCAGG - Intergenic
959852320 3:111103490-111103512 GCTAATAATCAATTACAGCAAGG - Intronic
960020349 3:112944771-112944793 ACTAATAAGAAATTGCAGCAAGG + Intronic
960860986 3:122153684-122153706 AGTACTAAGCAGCTGTAGCATGG + Intergenic
960893265 3:122473984-122474006 ACTAATAAGCAATTATAGCAAGG + Intronic
961025745 3:123555376-123555398 ACTAATAAGCAAGTATAGCAAGG + Intronic
961618337 3:128202504-128202526 ACTAATAAGAAGGTTTAGCAAGG - Intronic
962038795 3:131683299-131683321 AATAATCAGCAGTTGTAGCCAGG - Intronic
962516702 3:136158745-136158767 ACCAATAAGCAAATTTAGCAAGG + Intronic
962563756 3:136635753-136635775 ACTAATAAGCTATTATAGCAAGG + Intronic
962803173 3:138907630-138907652 ACTAATAAATAAATATAGCAAGG - Intergenic
963153067 3:142067251-142067273 ACTGATAAGCAATGACAGCAAGG + Intronic
963330304 3:143906963-143906985 ACTAATAAGCAATTATAGCAAGG - Intergenic
963656062 3:148052051-148052073 ACTAATAAGCAATTATTGTAAGG + Intergenic
963686632 3:148443318-148443340 ACTAGTAAGTGATTATAGCAAGG + Intergenic
963731575 3:148979310-148979332 ACTAATAAGCAATTATAGCAAGG - Intergenic
964264845 3:154883532-154883554 ACTACTAAGCAATTTTAGCAAGG + Intergenic
964267673 3:154918160-154918182 TCTAATAAGCAATTGTAGAAAGG + Intergenic
965451389 3:168842815-168842837 ACTAATAAGTAACTTTAGCAAGG + Intergenic
965458822 3:168935457-168935479 ACTAACAAGCAAATATAGCCAGG + Intergenic
965460996 3:168963143-168963165 AATAATAAGCAATTATATTAAGG - Intergenic
966464866 3:180219299-180219321 ACTAATAAACAATTATAGCAAGG + Intergenic
966545794 3:181146150-181146172 ACTGATAAGCAATTTTAGCAAGG + Intergenic
966678994 3:182620182-182620204 ACTACTAAGCAGGTTTAGCAAGG + Intergenic
966698487 3:182818866-182818888 ACTACTAAGCAGTTATTAAAAGG - Intronic
967430383 3:189377885-189377907 ACAAATAAGCAATTATATCAAGG - Intergenic
967476117 3:189921559-189921581 ACTAAGAAGCAAGTATAGAAAGG + Intergenic
967547955 3:190753974-190753996 ACTGATAAGCAATTATAGCAAGG - Intergenic
967872355 3:194241987-194242009 TCTAATAAGCAATTATAGCAAGG + Intergenic
968290714 3:197537382-197537404 ACTAATAAGTAAGTTTAGCAGGG - Intronic
968738096 4:2309498-2309520 AATAATAAGTAGATTTAGCAAGG - Intronic
969908248 4:10417679-10417701 ACTAATAAGGAGTCAGATCAAGG + Intergenic
970545010 4:17119718-17119740 ACTAAAAAGCAATGATAGCAAGG + Intergenic
970721996 4:18998643-18998665 ATTAATAAATAATTATAGCAAGG - Intergenic
971821584 4:31563486-31563508 ATTAATAAGCAATTATAGAAAGG + Intergenic
971991618 4:33904836-33904858 ACCAATAAGCAATTATAGCATGG + Intergenic
972470617 4:39400359-39400381 ACTAATAAGTGATTACAGCAAGG - Intergenic
973313764 4:48738234-48738256 ACCAATAAACAATTATAACAAGG + Intronic
974561138 4:63520786-63520808 ACTAATAAGTGATTATAGCAAGG + Intergenic
974854893 4:67449060-67449082 ACTAATAAGCAATTACAGCAAGG + Intergenic
975997195 4:80329698-80329720 ACAACTAAGCAGATATAGAAAGG - Intronic
976060348 4:81120655-81120677 ACTAAAAAGCACTTACAGCAAGG - Intronic
976211279 4:82673296-82673318 ACTAATAAGCTATTACAACAAGG + Intronic
976254727 4:83088157-83088179 ACTAATAAGCAGTTATGGCAAGG + Intergenic
976792263 4:88891851-88891873 AGTAATAAGCAGATATATAAAGG + Intronic
976994858 4:91418076-91418098 ACAAAAAAGCAGTTCTAGAAGGG + Intronic
977218051 4:94306605-94306627 ACTATTAAGCGGTTTTAGCATGG + Intronic
977374874 4:96189694-96189716 ACTAATGGGCTATTATAGCAAGG - Intergenic
977377972 4:96232515-96232537 ACTAATAAGCAAATATAGGAAGG + Intergenic
977616563 4:99093410-99093432 ACTAATAAGTGATTATAGCAGGG + Intergenic
977659647 4:99568289-99568311 ACTAATAAGCAATTATAGTAAGG + Intronic
978346008 4:107770187-107770209 ACTAATAAACAATTATAGTAAGG + Intergenic
978481881 4:109201764-109201786 ACTAATAAGCAATTATGGCAAGG + Intronic
979071334 4:116211085-116211107 ACTAATAAGAAATTATAGCAAGG - Intergenic
979647123 4:123083017-123083039 TCTAATAAGCAATTATAGCAAGG - Intronic
979903341 4:126251973-126251995 ACTAGTAAGCAATTATAACATGG + Intergenic
980422655 4:132584380-132584402 AGTACTACTCAGTTATAGCAAGG - Intergenic
980595257 4:134947079-134947101 AATATTAAGCAGTTACAGCAAGG + Intergenic
981324574 4:143431222-143431244 CCTAATAAACAGTTATAACTGGG + Intronic
981895631 4:149795910-149795932 ACTAACCAGCAGTTATACCCAGG + Intergenic
982146433 4:152399585-152399607 AAAAAAAAGCAATTATAGCAAGG + Intronic
982286022 4:153735851-153735873 AATAATAAGTGATTATAGCAAGG - Intronic
982588803 4:157277655-157277677 ACTAATAAATAATTATGGCAAGG + Intronic
982666163 4:158266538-158266560 ATTAATAAGTGATTATAGCAAGG - Intergenic
982799187 4:159681838-159681860 ACTAATAAGTAATTACAGCAAGG + Intergenic
982861471 4:160455947-160455969 ACTAATAAGCAATTATAACAAGG - Intergenic
983579737 4:169296147-169296169 ACTACTAAGTGATTATAGCAAGG + Intergenic
983596783 4:169476909-169476931 ACTAATCAGCCTTAATAGCAAGG - Intronic
983960215 4:173743456-173743478 ACTAATAAGAAGGTACAGTAAGG - Intergenic
984102717 4:175504926-175504948 ACTAATAAGCTATTATAGCAAGG + Intergenic
984754013 4:183308008-183308030 ACTAATAAGTGATTATAACAAGG + Intronic
985204141 4:187515766-187515788 ACTAATAAGAAGTGATTGCAGGG + Intergenic
986251657 5:6064269-6064291 ACAAATAAGCCAATATAGCAGGG + Intergenic
986515390 5:8556907-8556929 ACTAATAAATAAATATAGCAAGG - Intergenic
986973450 5:13365673-13365695 ATTAATAAGCAATTATAGCAAGG + Intergenic
986991696 5:13561045-13561067 ACTAATAAGTAAATATAGCAAGG + Intergenic
987839310 5:23201973-23201995 ACTAATATGCAATTATAGCAAGG + Intergenic
987997274 5:25300203-25300225 ACTAGCAAACAATTATAGCAAGG - Intergenic
988094595 5:26588001-26588023 GCTAATAAGTGATTATAGCAAGG - Intergenic
988445925 5:31286140-31286162 ACTAATAGTCAATGATAGCAAGG - Intronic
988635084 5:32974662-32974684 ACTAATAAGCAATTATAGTAAGG - Intergenic
988937305 5:36097912-36097934 GACTATAAGCAGTTATAGCAAGG - Intergenic
989490353 5:42045065-42045087 ACTGATAAGTCATTATAGCAAGG + Intergenic
989515244 5:42336005-42336027 ACTAATCAACCATTATAGCAAGG + Intergenic
990066614 5:51723813-51723835 ACTAATAAGAAATTAAAGCAAGG - Intergenic
990244985 5:53855455-53855477 ACTAATAAGTGATTATAGCAAGG + Intergenic
990379018 5:55203347-55203369 ACCAATAAACAATTATAGCAAGG + Intergenic
991119160 5:62991368-62991390 ACTAATAAGCAATTACAGCCAGG - Intergenic
991171990 5:63638516-63638538 ACTAATAAGCAGTTGTTCCATGG + Intergenic
991431918 5:66557196-66557218 ACAAATAAACACTTTTAGCAAGG - Intergenic
991619214 5:68528020-68528042 ACTAATAAGCAATTAGAGCAAGG - Intergenic
992482120 5:77162061-77162083 ACTAATAAGTAAATTTAGCAAGG + Intergenic
993137515 5:83988860-83988882 AGTAATAAGCCGTTATATAATGG + Intronic
993157599 5:84245439-84245461 ACTTTTAAGCAGTTATGACAAGG - Intronic
993467018 5:88261057-88261079 ACCAATAAGCAATTATAGCAAGG + Intronic
994026149 5:95086842-95086864 ATTAATAATCAGATATAGGAAGG - Intronic
995064815 5:107848512-107848534 ACTAATAAGTAAATTTAGCAAGG + Intergenic
995112929 5:108447329-108447351 ACTAATAAGCAATTATAGCAGGG + Intergenic
995637934 5:114216891-114216913 ACTAATAAGCAATTATAGCAAGG + Intergenic
995656288 5:114430469-114430491 ACTAATAAGTAAGTATTGCAAGG - Intronic
995735024 5:115290841-115290863 ACTAATAAACAAGTACAGCAAGG - Intronic
995950845 5:117711645-117711667 AGTAATAAGCAATTATAGCAAGG - Intergenic
995982733 5:118125071-118125093 ACTAATAAACAATTTCAGCAAGG + Intergenic
996428234 5:123338824-123338846 ACTAATAAGTAGATTTAGCAAGG - Intergenic
996468568 5:123832593-123832615 ACTAATAAGTGGATATAACAAGG - Intergenic
996546871 5:124688919-124688941 ACTACTAAGAAATTATAGCAAGG + Intronic
996567961 5:124901405-124901427 ACTCATTTGCATTTATAGCAAGG + Intergenic
997857564 5:137386010-137386032 GCTAATAAGCAATTACAGCAAGG + Intronic
998185917 5:139980077-139980099 AGTGATAAGCAGAAATAGCATGG - Intronic
998962112 5:147499278-147499300 ACTAGTAAGTGATTATAGCAAGG + Intronic
1000054155 5:157589345-157589367 ATTAATATGTAATTATAGCAAGG - Intergenic
1000493137 5:161940825-161940847 TTTAATAAGCTATTATAGCATGG - Intergenic
1000542957 5:162563580-162563602 ACTAATAAACAATAATAGGAAGG + Intergenic
1000822165 5:165998056-165998078 ACGAATGAGCAGTTAGACCAGGG - Intergenic
1001499709 5:172220898-172220920 CCTAATAAGCAATTATAGCAAGG + Intronic
1001538508 5:172518741-172518763 ACTAATAAGCAATTATACCAAGG + Intergenic
1002558671 5:180064806-180064828 ACTAATCTGTAGTTAAAGCATGG - Intronic
1002863555 6:1101328-1101350 ACTAATAAGGAGTTCAACCAGGG + Intergenic
1002892190 6:1344618-1344640 ACTAATAAACAATTACAGCAAGG + Intergenic
1003364835 6:5463322-5463344 ACTAATAAACAACTTTAGCAAGG - Intronic
1003854333 6:10257128-10257150 ACTAATAAGCAATTATAACAAGG + Intergenic
1004033436 6:11896566-11896588 ACTAAAAAGCTATTATAGCAAGG - Intergenic
1004213421 6:13677141-13677163 AAAAATAAGCAATCATAGCAAGG + Intronic
1005210979 6:23462635-23462657 ACTAATAAGCAAGTATAGCAAGG + Intergenic
1005222672 6:23605879-23605901 AATAATAAACAATTATAACAAGG + Intergenic
1005246978 6:23898168-23898190 ACTAATAAGCAATTATAGTAAGG - Intergenic
1005363954 6:25059069-25059091 ACTAATAAGCAGTTACAGCAGGG + Intergenic
1006074361 6:31521043-31521065 ACTAACAAGCAATTATAGCAAGG + Intergenic
1008073839 6:47125421-47125443 ATTGATAAGCAATTATAGCAAGG - Intergenic
1008235517 6:49042900-49042922 TCTAATATGCAATTATTGCAAGG - Intergenic
1008744419 6:54652031-54652053 ACTAATAAATGATTATAGCAAGG - Intergenic
1008948267 6:57123878-57123900 ACTAATAAGCAATTATAGCAAGG - Intronic
1009640023 6:66322937-66322959 AATAGTATGCAGTTATAGCCTGG + Intergenic
1009873618 6:69478370-69478392 ATTAATATGCAATTATAGCAAGG + Intergenic
1010339237 6:74728612-74728634 AGCAATAACCAGTTATTGCAAGG + Intergenic
1010811317 6:80302279-80302301 ACTGATAAACAATTTTAGCAAGG + Intronic
1011081471 6:83494571-83494593 ACAAATAAGCAATTACAGCAAGG - Intergenic
1011094672 6:83647048-83647070 ACTAATAAGCAATTATAGCAAGG - Intronic
1011257702 6:85440525-85440547 ATTAGCAAGCAATTATAGCAGGG - Intergenic
1011265256 6:85511276-85511298 AATAATAAGCAATTTTACCAGGG - Intronic
1011446368 6:87445541-87445563 AATAATAAGCAGCTATAAAAAGG - Intronic
1011577609 6:88820557-88820579 ACTAATAAGCAATTATAGCCAGG + Intronic
1012735639 6:102938290-102938312 ACTAATAAGTGATTATACCAAGG - Intergenic
1012891749 6:104904871-104904893 ACTAATAAGCAATTATAGCAAGG - Intergenic
1013306965 6:108857377-108857399 ACTAATAAGTGATTATAGTAGGG - Intronic
1013440632 6:110163018-110163040 ACTAGTAAGCAATTACAGCATGG + Intronic
1013887314 6:114985002-114985024 ACTAATAAACATTTTTAGAATGG + Intergenic
1014228427 6:118874717-118874739 ACTAATAAGTGATTATAGCAAGG + Intronic
1014528661 6:122532841-122532863 ACTCAAAAGAATTTATAGCAGGG - Intronic
1014784627 6:125604168-125604190 ACTAATAAGCAATAGTAGCAAGG + Intergenic
1015093397 6:129385662-129385684 ACTAATCAGGAGTCATAGCACGG - Intronic
1015314341 6:131801047-131801069 ACTAATAAGCAAGTTTAGCAAGG + Intergenic
1015768237 6:136741774-136741796 ATTAATAAGCAATTATAGCAGGG + Intronic
1016222354 6:141690778-141690800 ACTAAGCAGCAGTTACAGCAGGG + Intergenic
1016601762 6:145870205-145870227 ACTAATAAGAGATTATAGAAAGG - Intronic
1016726768 6:147379771-147379793 GCTAATAAACAGTTTTAGCAAGG + Intronic
1016799584 6:148155358-148155380 ATTAATGGGCAGTTACAGCAGGG - Intergenic
1017397689 6:154021808-154021830 GCTAATAAGCAATTATAACAAGG - Intronic
1017621242 6:156300918-156300940 ACTTATAAGAAATTATAGCAAGG + Intergenic
1018264031 6:162001511-162001533 ACTAGTTAGTAATTATAGCAAGG - Intronic
1018526726 6:164718991-164719013 ACTAATAAGCAATTATGGCAAGG + Intergenic
1018550111 6:164986827-164986849 ACTAGCAAGCAAGTATAGCAAGG - Intergenic
1020075661 7:5256910-5256932 ACTAATAAGCGATTATAGCAAGG + Intergenic
1020587917 7:10094354-10094376 ACTAATAAGCAATTACTACAAGG - Intergenic
1020969538 7:14918386-14918408 ACTAATAAACAAATGTAGCAAGG + Intronic
1021181807 7:17515344-17515366 ACTAATAAGCCTTTGTTGCAGGG + Intergenic
1021341776 7:19472943-19472965 ACTAATGAGCAATTATAGCAAGG + Intergenic
1021353480 7:19625243-19625265 ACTAATAAGCTATTATAGAATGG + Intergenic
1022420655 7:30219556-30219578 ACTAATAAGTGATGATAGCAAGG + Intergenic
1023096479 7:36665399-36665421 ACTAATAAGCAATTATAGCAAGG - Intronic
1023434083 7:40124362-40124384 ACTAATAAGTGATTACAGCAAGG - Intergenic
1023524734 7:41088495-41088517 ACTAATCAACAATTATAGTAAGG - Intergenic
1023597050 7:41841190-41841212 ACTAATAAGCAATTATAGCAAGG - Intergenic
1023878178 7:44303033-44303055 ACTAATAAATGATTATAGCAAGG + Intronic
1023962635 7:44939811-44939833 GCTAATAAACAATTATAGCAAGG + Intergenic
1024019783 7:45357260-45357282 ACTAATAAGCAGTTATAGTAAGG + Intergenic
1024062083 7:45705835-45705857 ACTAAGAAGCAATTATAGTAAGG + Intronic
1024099897 7:46019650-46019672 ACTAATAACCAAGTTTAGCAAGG + Intergenic
1024370509 7:48578352-48578374 ACTAATAGCCATTTATATCAAGG + Intronic
1024789782 7:52951619-52951641 AATAAAAAGCAATTATAACAAGG + Intergenic
1024793061 7:52988727-52988749 ACTTATAAGTGATTATAGCAAGG + Intergenic
1025203412 7:56976644-56976666 ACTAATAAGCGATTATAGCAAGG - Intergenic
1025289454 7:57701723-57701745 AATAATAAGCATTTACAGCATGG + Intergenic
1025668532 7:63600283-63600305 ACTAATAAGCGATTATAGCAAGG + Intergenic
1026080468 7:67214357-67214379 ACTAACAAGTGATTATAGCAAGG - Intronic
1027821521 7:83051337-83051359 AATAATAAGTGATTATAGCAAGG + Intronic
1028063964 7:86358008-86358030 AATAGTAAGCAAATATAGCAAGG + Intergenic
1028437784 7:90824529-90824551 GCTCATAAACAGTTATATCAAGG + Intronic
1028778134 7:94703727-94703749 ACTAATAAACAATTATAATAAGG + Intergenic
1028816289 7:95149503-95149525 ATTGATAAGCAATTATAGCAAGG + Intronic
1028926638 7:96364385-96364407 ACTAATAAGCCATTATAACCAGG - Intergenic
1030423535 7:109340770-109340792 ACTAATTAACAATGATAGCAAGG - Intergenic
1030804997 7:113906233-113906255 ACAAATATGCAGTTATTGCTGGG + Intronic
1030827438 7:114176828-114176850 ACTAAAAGGCAGATAAAGCATGG - Intronic
1030834919 7:114271139-114271161 ACTAATAAGTAATTACAGCAAGG - Intronic
1031189227 7:118525423-118525445 AATACTATGCAGTTATAGAAAGG - Intergenic
1031203520 7:118723040-118723062 ACTAATTAGCAATTGTTGCAAGG - Intergenic
1031218353 7:118928031-118928053 AGTAATAAGAAAGTATAGCAAGG + Intergenic
1031408765 7:121417775-121417797 ACAAATAGACATTTATAGCAAGG - Intergenic
1031616351 7:123886065-123886087 ATTAATAAACAATTATAGCCGGG + Intergenic
1032178608 7:129655299-129655321 ACTAGTAAGTAATTACAGCAAGG - Intronic
1034056246 7:148038141-148038163 ACTAATAAGAAGATATGGAAAGG - Intronic
1035440693 7:158895983-158896005 AATAATAAGCAATTACAGCAAGG - Intronic
1035450697 7:158975116-158975138 ACTAATAAGCAATTATAGCAAGG + Intergenic
1035595793 8:856506-856528 ACTAATAAACAGTTTTAGCAGGG + Intergenic
1035612325 8:975975-975997 ACCAATAAACAATTATAGCAAGG + Intergenic
1035742791 8:1941240-1941262 ACTAATAAACAGGTTGAGCAAGG + Intronic
1035992979 8:4512564-4512586 ACTAATAAGCAATTATAGCAGGG + Intronic
1036580398 8:10069134-10069156 ACTAATAAGAAATTACAGCAAGG - Intronic
1036737903 8:11335199-11335221 ACTAATAAACAGTTATAGCAAGG + Intergenic
1037016939 8:13919691-13919713 ACTAATAAGCAATTATAGAAAGG - Intergenic
1037105358 8:15100231-15100253 ACTGTTAAGTAATTATAGCAAGG + Intronic
1038752526 8:30309453-30309475 ACTGATAAGTAACTATAGCAAGG - Intergenic
1038821265 8:30954043-30954065 ACGAATAAGTGGTTATAGCAGGG + Intergenic
1039140906 8:34386767-34386789 ACTAGTAAGCAACTATAGTAAGG + Intergenic
1039624446 8:39033280-39033302 ACTAAAAAGCAATTACAGTAAGG - Intronic
1039651933 8:39351312-39351334 ACAAATAAGTGGTTATAGCAAGG + Intergenic
1040420330 8:47233687-47233709 AATAATAAGCACTTATAACGTGG + Intergenic
1040611447 8:48987176-48987198 ACTAATCAGCAATTATAGCAAGG - Intergenic
1040613565 8:49011395-49011417 AATAATATTCAGTTATACCAAGG + Intergenic
1040821610 8:51564850-51564872 ACTAATAAGTGATTATAACAAGG - Intronic
1041305679 8:56455960-56455982 ACTAATAAGCAATTATAGCAGGG + Intergenic
1041613309 8:59876460-59876482 ACTTATAGGCAATTATAACAAGG + Intergenic
1041879131 8:62727476-62727498 ACTAATAAACAATTATAACAAGG + Intronic
1042053893 8:64741633-64741655 ACAAATAATCAATTATAGCAAGG + Intronic
1042076814 8:65005337-65005359 ACTAATAAGAAATTATAGCAAGG + Intergenic
1042366643 8:67944645-67944667 ACTAATGAGTAATTACAGCAAGG + Intergenic
1042383325 8:68144548-68144570 ACTAATAAGCAATTATAGCTAGG - Intronic
1042527029 8:69774118-69774140 ACTAATAAGCCTTTATTGAATGG + Intronic
1042779380 8:72473832-72473854 ACAAATAAGCTATTATAGTAAGG + Intergenic
1043144555 8:76636689-76636711 ACTAATAAGCAATTATAGGAAGG + Intergenic
1043343993 8:79277508-79277530 ACTAACAAACAATTCTAGCAAGG + Intergenic
1043626213 8:82262268-82262290 ACTAATAACTGATTATAGCAAGG - Intergenic
1044050504 8:87496726-87496748 ACTAATAAGCTATTATAACAAGG - Intronic
1045400749 8:101814736-101814758 ACTAATAAGGGATTATAGCAAGG + Intronic
1045577012 8:103433949-103433971 TCTAATAAGCTATTTTAGCAAGG + Intronic
1046502002 8:115089809-115089831 ACTAATAAGCAAATATAGCAAGG - Intergenic
1046574275 8:116006622-116006644 ACTAATAAATATTTATAGTAAGG + Intergenic
1046825191 8:118682253-118682275 ACTAATAAGCAAGTTTAGCAAGG - Intergenic
1047199025 8:122748328-122748350 ACAAATGAGGATTTATAGCAAGG - Intergenic
1047651146 8:126923613-126923635 ATGAATAAGCAGTTATAGCAAGG - Intergenic
1048514083 8:135089614-135089636 AATAATAAGCATATATAGTAGGG - Intergenic
1048724962 8:137373112-137373134 AATAATAAGCTGTTAGAGAAGGG - Intergenic
1049490098 8:142893709-142893731 AATAATAAGCAGCTATACCCAGG - Intronic
1050327552 9:4511850-4511872 ACTAATAAGTGATTTTAGCAGGG + Intronic
1050452289 9:5795863-5795885 TCTAATAAGTGATTATAGCAAGG + Intronic
1050753218 9:8965917-8965939 ACTGATAAACAATTTTAGCAAGG + Intronic
1050854477 9:10334694-10334716 ACTAATCAGCCGTTATAGCAAGG + Intronic
1051116432 9:13699367-13699389 ACTAATAAGCAATTATGGAAAGG - Intergenic
1052007389 9:23364686-23364708 ACTAATAAATAATTTTAGCAAGG + Intergenic
1052093956 9:24362228-24362250 AATAATCAGCAGTGATAGCCAGG + Intergenic
1052582436 9:30375589-30375611 AATAATAAGTGATTATAGCAAGG + Intergenic
1052639762 9:31151947-31151969 ACTAAAAGGCAATTATAACAAGG + Intergenic
1052718563 9:32147323-32147345 ACTAATACACAGTTATAGGGAGG + Intergenic
1053585214 9:39450862-39450884 ACTAATAAGTGTTTTTAGCAAGG + Intergenic
1054581105 9:66914362-66914384 ACTAATAAGTGTTTTTAGCAAGG - Intronic
1055015344 9:71611129-71611151 ACTAGTAAGCAATTATAGCAAGG + Intergenic
1055448494 9:76407983-76408005 ACTAATAAATAAGTATAGCAAGG - Intergenic
1055746529 9:79452279-79452301 ACTAATAAACAAATATAGCAAGG - Intergenic
1055837591 9:80462335-80462357 ACTAATAAACATTTATAGCAAGG + Intergenic
1055841422 9:80509497-80509519 ACTAACAAATAGTTACAGCAGGG - Intergenic
1056005329 9:82263720-82263742 ACCTATAAGCAGTTGTAGGATGG + Intergenic
1056561796 9:87736338-87736360 ACTAATAAGTGGTTACAGCAAGG + Intergenic
1056857716 9:90149582-90149604 AATAAGAAGCAATTATAGCAAGG - Intergenic
1056996553 9:91467478-91467500 ACTAATAAGTGATTATAGCAAGG - Intergenic
1057933042 9:99212493-99212515 AGTCCTAAGCAGCTATAGCATGG - Intergenic
1058205023 9:102093960-102093982 ACTAATAAGCAAGTATACCAAGG + Intergenic
1058480429 9:105387679-105387701 AGTAATAAGCATTTAAAGAAAGG + Intronic
1058991871 9:110261616-110261638 ACAAATAAGCAGTAAAAACATGG + Intergenic
1059488595 9:114647612-114647634 ACTAATAAGAGATTATAGCAAGG - Intergenic
1060038528 9:120280313-120280335 AGTAATGAGCAGTTATAGACTGG + Intergenic
1060162493 9:121378333-121378355 GCTAATAAGCAATGATAACAAGG + Intergenic
1060488890 9:124067451-124067473 ATTAATAAGTACTTATAGTAAGG + Intergenic
1203611101 Un_KI270749v1:5217-5239 AATAATAAGCATTTACAGCATGG - Intergenic
1185972113 X:4676663-4676685 ACAAAAAAGCAGTCATAGGATGG - Intergenic
1187351875 X:18526298-18526320 ACTACTAAACAATTACAGCAAGG - Intronic
1187736488 X:22310059-22310081 ACTAATAAGCAATTAAAGCAAGG - Intergenic
1187800517 X:23057286-23057308 ACTAATAAGCTATTATAGCAAGG - Intergenic
1188303485 X:28533256-28533278 ACTATTCACCAGTGATAGCAAGG - Intergenic
1188740792 X:33778200-33778222 ACTAATAAACAATCATGGCAAGG - Intergenic
1188766512 X:34099440-34099462 ACTAATGAGCAATTTTAGCAAGG + Intergenic
1189574244 X:42334095-42334117 AGTAATAAGCAAGTATAGCAAGG - Intergenic
1189932343 X:46026701-46026723 ACTAATAAGTGAGTATAGCAAGG - Intergenic
1190547128 X:51539771-51539793 ACTAATAAGCAATTATAACGAGG - Intergenic
1190551763 X:51589586-51589608 ACTAATAAGCAATTATAGCAAGG + Intergenic
1190749587 X:53349915-53349937 ACTAATAAGCAATTATAGCAAGG + Intergenic
1190961837 X:55258250-55258272 ATTAATAAGCATATTTAGCAAGG + Intronic
1191159718 X:57316030-57316052 ACTGATAAACAATTTTAGCAAGG + Intronic
1191684354 X:63874001-63874023 ACTAATAAGTGATTATAGCAGGG + Intergenic
1191923545 X:66283634-66283656 ACTAGAAGGCAATTATAGCAAGG + Intergenic
1192759641 X:74083681-74083703 ACTAATAAGCAAGTTTAACAAGG + Intergenic
1192862516 X:75091708-75091730 ACTAAAAAGCAATTACAGCAAGG + Intronic
1193623314 X:83784455-83784477 ACTACTAAGCTATTATAGCAAGG + Intergenic
1193864120 X:86708414-86708436 ACTAATAAGAGATTATAGTAAGG + Intronic
1194060735 X:89194079-89194101 ATTAATAAGCAAGTGTAGCAAGG - Intergenic
1194171539 X:90590303-90590325 ACTAATAAGCAATTAAAATAAGG - Intergenic
1194184341 X:90754641-90754663 ACTAATAATCAATTATAGCAAGG + Intergenic
1194369367 X:93052588-93052610 ACTAATAAGCAATTATAGCCAGG - Intergenic
1194542933 X:95196946-95196968 ACTAATAAGCAATTATAGCAAGG - Intergenic
1194632852 X:96307707-96307729 ACTAATAAACGATTATAGCAAGG + Intergenic
1195028557 X:100903364-100903386 ACTAATAAACAATTATAGCAGGG + Intergenic
1195826623 X:109008803-109008825 ACTAATAAGAGATTATAGCAAGG + Intergenic
1195846481 X:109234622-109234644 ACTAATAAGTAAATTTAGCAAGG + Intergenic
1195898005 X:109768363-109768385 ACTAATAAACAATTATAGCAAGG + Intergenic
1195974059 X:110506313-110506335 ACTAATAAATGATTATAGCAAGG + Intergenic
1196000546 X:110780035-110780057 ACTAATAAGTGATTATTGCAAGG - Intronic
1196313212 X:114193332-114193354 ACTAATAAGCAATTATAGCAAGG + Intergenic
1196568525 X:117237700-117237722 AGTAATAAGCAAGTTTAGCAAGG - Intergenic
1196700958 X:118667989-118668011 ACTAATAAGCAGATTTAGTAAGG - Intronic
1196971460 X:121113627-121113649 TCTAATATGCAGTTATAATATGG + Intergenic
1197030794 X:121812107-121812129 ACTCATAAGAGATTATAGCAAGG - Intergenic
1197071496 X:122303545-122303567 ACAAATAAGTGATTATAGCAAGG - Intergenic
1197539430 X:127738295-127738317 ACTAAAAAGCAAATATAGAAAGG + Intergenic
1198384033 X:136110912-136110934 ACTAATAAGCAAATTAAGCAAGG - Intergenic
1199062141 X:143370065-143370087 ACTCATAACCAATTACAGCAAGG + Intergenic
1199292125 X:146116374-146116396 ACTAATAAGCAATTATAACAAGG - Intergenic
1199702630 X:150394787-150394809 ACCAATAAGTCATTATAGCAAGG - Intronic
1200328475 X:155267828-155267850 ACTAATAAGCAAGTTCAGCAAGG - Intergenic
1200517771 Y:4168052-4168074 ACTAATAAGCAATTAAAATAAGG - Intergenic
1200530932 Y:4336566-4336588 ACTAATAATCAATTATAGCAAGG + Intergenic
1200677557 Y:6168815-6168837 ACTAATAAACAATTGTAGCAAGG - Intergenic