ID: 904858411

View in Genome Browser
Species Human (GRCh38)
Location 1:33517229-33517251
Sequence TGACCACTTCTGCCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904858411_904858423 15 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858423 1:33517267-33517289 AGACCTGTGGGCTGGGCAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 402
904858411_904858417 3 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858417 1:33517255-33517277 GGGCCCTGCTGGAGACCTGTGGG 0: 1
1: 0
2: 2
3: 23
4: 245
904858411_904858422 14 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858422 1:33517266-33517288 GAGACCTGTGGGCTGGGCAGTGG 0: 1
1: 0
2: 5
3: 65
4: 559
904858411_904858420 7 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858420 1:33517259-33517281 CCTGCTGGAGACCTGTGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 285
904858411_904858415 -8 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858415 1:33517244-33517266 AGTGGTCAGAGGGGCCCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 300
904858411_904858421 8 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858421 1:33517260-33517282 CTGCTGGAGACCTGTGGGCTGGG 0: 1
1: 0
2: 2
3: 33
4: 292
904858411_904858416 2 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858416 1:33517254-33517276 GGGGCCCTGCTGGAGACCTGTGG 0: 1
1: 0
2: 3
3: 41
4: 407
904858411_904858425 30 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858425 1:33517282-33517304 GCAGTGGGTTCAGAGCCTGCTGG 0: 1
1: 0
2: 3
3: 32
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904858411 Original CRISPR TGACCACTTCTGCCCACAGC TGG (reversed) Intronic