ID: 904858417

View in Genome Browser
Species Human (GRCh38)
Location 1:33517255-33517277
Sequence GGGCCCTGCTGGAGACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904858411_904858417 3 Left 904858411 1:33517229-33517251 CCAGCTGTGGGCAGAAGTGGTCA 0: 1
1: 0
2: 3
3: 20
4: 234
Right 904858417 1:33517255-33517277 GGGCCCTGCTGGAGACCTGTGGG 0: 1
1: 0
2: 2
3: 23
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904858417 Original CRISPR GGGCCCTGCTGGAGACCTGT GGG Intronic