ID: 904858478

View in Genome Browser
Species Human (GRCh38)
Location 1:33517653-33517675
Sequence AGGGTTCCCCCTTATTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904858478_904858482 15 Left 904858478 1:33517653-33517675 CCACTGGAATAAGGGGGAACCCT 0: 1
1: 0
2: 0
3: 10
4: 85
Right 904858482 1:33517691-33517713 TTTGGAGAGACGTAAAAAGATGG 0: 1
1: 0
2: 0
3: 11
4: 243
904858478_904858484 17 Left 904858478 1:33517653-33517675 CCACTGGAATAAGGGGGAACCCT 0: 1
1: 0
2: 0
3: 10
4: 85
Right 904858484 1:33517693-33517715 TGGAGAGACGTAAAAAGATGGGG 0: 1
1: 0
2: 2
3: 40
4: 240
904858478_904858483 16 Left 904858478 1:33517653-33517675 CCACTGGAATAAGGGGGAACCCT 0: 1
1: 0
2: 0
3: 10
4: 85
Right 904858483 1:33517692-33517714 TTGGAGAGACGTAAAAAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 201
904858478_904858481 -3 Left 904858478 1:33517653-33517675 CCACTGGAATAAGGGGGAACCCT 0: 1
1: 0
2: 0
3: 10
4: 85
Right 904858481 1:33517673-33517695 CCTTATTTAAATGTTTGTTTTGG 0: 1
1: 1
2: 3
3: 50
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904858478 Original CRISPR AGGGTTCCCCCTTATTCCAG TGG (reversed) Intronic
900708755 1:4097500-4097522 AGGGTCCCACCTTATCCCTGGGG - Intergenic
901026233 1:6280076-6280098 AGGCTGACCCCTGATTCCAGAGG - Intronic
904858478 1:33517653-33517675 AGGGTTCCCCCTTATTCCAGTGG - Intronic
906545271 1:46615886-46615908 AGAGTTCCACCTTACTCCTGTGG + Intronic
908212047 1:61910737-61910759 AGGGTCTCCCCTTATTCCTCAGG + Intronic
909580144 1:77224233-77224255 AGGAGTCCCCCTTATCCAAGGGG + Intergenic
914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG + Intergenic
916017553 1:160763486-160763508 CGGTCTCCCCCTTATTCAAGAGG + Intergenic
916862735 1:168823940-168823962 AAGGTTCCCCCCTTTTCCAAAGG + Intergenic
922237143 1:223730772-223730794 TGGGTGCCCCCTTAGTCAAGGGG - Intronic
1071993887 10:91128007-91128029 AGGGTCAACCCATATTCCAGGGG + Intergenic
1074514462 10:114152474-114152496 AGAGTTCCCCCTTATCTGAGGGG - Intronic
1074821235 10:117180258-117180280 AGGATTTCCCCTTGTTTCAGGGG + Intergenic
1076022429 10:127085069-127085091 AGGCTTCTCCATTATTACAGAGG - Intronic
1077119986 11:902719-902741 TGGGTTCCCCCTGAATCCAGAGG - Intronic
1078750579 11:14158213-14158235 ATGGTTCACTCTTATTCCATGGG + Intronic
1079135369 11:17773466-17773488 AGGGTTCTCCCCGTTTCCAGCGG + Intronic
1081074599 11:38654958-38654980 AGGTTTACCTCTTATTCCAGAGG + Intergenic
1081965177 11:47165038-47165060 AGGCCTCCCCCTGGTTCCAGAGG + Exonic
1083512964 11:63228562-63228584 AGGGTTTCCTTTTCTTCCAGTGG - Exonic
1084755815 11:71237948-71237970 AGGGGGCCCCCTTATCCCATGGG - Intronic
1088709208 11:112491578-112491600 ATGGTTCTTCCTTCTTCCAGGGG - Intergenic
1090584075 11:128191212-128191234 AAGCTTCACCCTTATTCCATTGG - Intergenic
1094498987 12:31006635-31006657 AGGGCTCCTCCCTATGCCAGGGG - Intergenic
1096457688 12:51800918-51800940 AGGCCTCCCCTTTATTCAAGGGG + Intronic
1102398220 12:112605828-112605850 GGGGTTCCCCCTTTAGCCAGTGG + Intronic
1103955468 12:124574089-124574111 GGGGTTCCCCCTCATTTCTGGGG + Intergenic
1114705446 14:24721873-24721895 AGGCTTAACCCTTAATCCAGTGG - Intergenic
1115132215 14:30067475-30067497 AGGTTAACCCCTTATTCCAGTGG - Intronic
1116700180 14:48231273-48231295 GGCCTTCCCCCTTATTCCTGAGG + Intergenic
1122037146 14:98957179-98957201 TGGGATCCCCCTCATTCCAAGGG - Intergenic
1127477430 15:59348007-59348029 AGGGTTCCAGGTGATTCCAGTGG - Intronic
1132318832 15:100910216-100910238 AGCCTTCCCCCTTATCCCTGTGG + Intronic
1133379168 16:5315537-5315559 AGGGCTCCCCTTCATTTCAGGGG + Intergenic
1134593573 16:15476778-15476800 AGGGTACCACCTTCTTCCACTGG + Intronic
1142565511 17:837584-837606 ACGGCTCCCCCTTGTTCCTGGGG + Intronic
1142652531 17:1364576-1364598 ATAGTTCCCCCTTATCCAAGAGG + Intronic
1144838045 17:18167822-18167844 AGGCTCCCCTCTTATACCAGTGG + Intronic
1148192091 17:45686384-45686406 AGGGTTCCTCCTGCTTCCGGGGG + Intergenic
1149356822 17:55847747-55847769 AGAGTTCCCCCTTGTTCAAGGGG + Intergenic
1154206693 18:12343548-12343570 ATGGTTCCCCCGTCTTTCAGGGG + Intronic
1155870106 18:31016634-31016656 AGGGTTCCCTCTAAAACCAGAGG + Intronic
1157599833 18:48887138-48887160 GGGGGTCCCCCTTACTCCTGAGG + Intergenic
1159753020 18:72326293-72326315 TGGATTGCCCCTTTTTCCAGGGG + Intergenic
1159876819 18:73821615-73821637 AGGATTCCCCCTTTTTCTATTGG + Intergenic
1161875534 19:6905693-6905715 ATGGTTCCCCATTATTCTTGGGG - Intronic
1165413957 19:35679739-35679761 GGGGTTCCCATTTACTCCAGTGG + Intergenic
1166680798 19:44765433-44765455 AGGGCTCGCCACTATTCCAGGGG - Intergenic
1167976909 19:53234760-53234782 GGGGTTCCCTCCTGTTCCAGTGG + Intergenic
926809348 2:16742560-16742582 ATGGTTCCCTCAAATTCCAGAGG - Intergenic
931247189 2:60500995-60501017 AGGGTTCTCCCATTTTACAGAGG - Intronic
932560276 2:72862056-72862078 AGTGTTTCCCCTTTTCCCAGGGG + Intergenic
935391785 2:102560413-102560435 TGGGGTCCCCGTTATTCAAGAGG + Intergenic
935470000 2:103447658-103447680 AAGGTTCCCCCTTAAACCAGGGG - Intergenic
935597258 2:104888874-104888896 AGGGTTTCCCCTCTTTTCAGTGG - Intergenic
941672613 2:168310874-168310896 AGGGGTTCCCATTTTTCCAGTGG + Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
1168834988 20:871971-871993 AGGGCTCCTCCTTATGCCAGGGG + Exonic
1168985955 20:2049372-2049394 TGGCTTCACCCATATTCCAGAGG + Intergenic
1184436636 22:44482704-44482726 TGGATTCCCACTTATTCCAGAGG - Intergenic
955517589 3:59742979-59743001 AGGGCTCACTCTTATTCCAAGGG + Intergenic
958987817 3:100803045-100803067 AGGGTTCTCCCTTGCCCCAGGGG - Intronic
962234597 3:133696463-133696485 AGAGTCCCACCTTATTCAAGGGG - Intergenic
963991889 3:151665701-151665723 AGGGTTCCCCCTAATCTCTGGGG - Intergenic
964288962 3:155154227-155154249 AGGGGTTCCACTTATTTCAGAGG - Intronic
991693760 5:69250576-69250598 TGGGTTCCCCTCTGTTCCAGGGG + Intronic
995546662 5:113239388-113239410 AGGGTACTCCCTTTCTCCAGGGG + Intronic
996032254 5:118718830-118718852 AGGGTTCCCCCTTTATCTTGTGG - Intergenic
997804781 5:136906270-136906292 AGGGTTCCCCCTTATGGGACAGG - Intergenic
1003455993 6:6282728-6282750 AGGGTCACACCTCATTCCAGGGG + Intronic
1004553241 6:16670136-16670158 TGCCTTCCCCCTTATTCCACAGG + Intronic
1009411359 6:63368780-63368802 AGGCTTCCTTCTTACTCCAGAGG - Intergenic
1013505406 6:110795160-110795182 AGGGTTCCCCCTTGTTGCACAGG + Intronic
1014173078 6:118300551-118300573 AGAGTTCCTTCTTATTCAAGGGG - Intronic
1019730668 7:2627679-2627701 AGGGTTCAGCCTAGTTCCAGGGG - Intergenic
1026558542 7:71428850-71428872 AGGGCTCCCCTGTGTTCCAGAGG + Intronic
1035919227 8:3658847-3658869 AGGTTTTCTCCTAATTCCAGGGG + Intronic
1035955434 8:4072652-4072674 AGGCTTCCCCTTTATTTCTGTGG + Intronic
1036525408 8:9530038-9530060 ATGGTCACCCTTTATTCCAGGGG + Intergenic
1038121471 8:24621309-24621331 AGGATTCCTCCTGATTCCATTGG - Intergenic
1038507374 8:28096210-28096232 AGGGTTCCCACTGATTCTATGGG + Intronic
1038695964 8:29806534-29806556 AGGGTTCCCACGTCTTGCAGAGG - Intergenic
1041177847 8:55215187-55215209 AGGGTTCCCCCTAATGTCACAGG - Intronic
1050730868 9:8708078-8708100 AGATTTCCCCTTTATTTCAGAGG - Intronic
1052237933 9:26235071-26235093 GGGGTGCCCCCTCATTCCTGAGG - Intergenic
1054758109 9:68979501-68979523 AGGGTTCCTCCTTTTTAAAGAGG - Intronic
1055804296 9:80075769-80075791 AGGATTCCCCCTTATCCTTGAGG + Intergenic
1056593782 9:87988105-87988127 AGGGGTCCACCTTATTCCTCTGG + Intergenic
1056809902 9:89756283-89756305 AGGGTTTCCTCTGATTCCAAAGG + Intergenic
1058820546 9:108725301-108725323 AGGCTCCCACCTTTTTCCAGGGG - Intergenic
1189309143 X:40008000-40008022 CGGGTTCCTCCTGCTTCCAGAGG - Intergenic
1191183080 X:57582667-57582689 GTGGTTCACCCTTATTCCAGAGG + Intergenic
1191214294 X:57919708-57919730 GTGGTTCACCCTTATTCCAGAGG - Intergenic
1193993926 X:88342255-88342277 ATTGTTACCCATTATTCCAGAGG - Intergenic
1198423368 X:136490839-136490861 AGTGTTCCCCACTATTCCATGGG - Intronic
1200117589 X:153776167-153776189 AGGGCACCCCCTTCTCCCAGAGG + Exonic