ID: 904858805

View in Genome Browser
Species Human (GRCh38)
Location 1:33519832-33519854
Sequence CACGAAGCCCGCAATAATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904858800_904858805 16 Left 904858800 1:33519793-33519815 CCTCCTTCCTGCACGGTACCTGT 0: 1
1: 0
2: 1
3: 5
4: 124
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858799_904858805 20 Left 904858799 1:33519789-33519811 CCTGCCTCCTTCCTGCACGGTAC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858795_904858805 25 Left 904858795 1:33519784-33519806 CCCGCCCTGCCTCCTTCCTGCAC 0: 1
1: 1
2: 20
3: 185
4: 1706
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858801_904858805 13 Left 904858801 1:33519796-33519818 CCTTCCTGCACGGTACCTGTGCT 0: 1
1: 0
2: 0
3: 4
4: 97
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858802_904858805 9 Left 904858802 1:33519800-33519822 CCTGCACGGTACCTGTGCTTGTA 0: 1
1: 0
2: 0
3: 6
4: 54
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858798_904858805 21 Left 904858798 1:33519788-33519810 CCCTGCCTCCTTCCTGCACGGTA 0: 1
1: 0
2: 1
3: 23
4: 739
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858803_904858805 -2 Left 904858803 1:33519811-33519833 CCTGTGCTTGTAGAGATAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 131
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
904858796_904858805 24 Left 904858796 1:33519785-33519807 CCGCCCTGCCTCCTTCCTGCACG 0: 1
1: 0
2: 5
3: 120
4: 1565
Right 904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904858805 Original CRISPR CACGAAGCCCGCAATAATGA GGG Exonic
901227020 1:7619356-7619378 CACGAAGCCAGCACTCAAGATGG - Intronic
904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG + Exonic
905630402 1:39515128-39515150 CCCGAAGCCCCCGATCATGACGG - Intronic
905667359 1:39771061-39771083 CCCGAAGCCCCCGATCATGACGG + Exonic
906017249 1:42592826-42592848 CAGGAAGCTCACAATCATGATGG - Intronic
909525100 1:76613759-76613781 CAGGAAACCCACAATCATGACGG - Intronic
921344635 1:214169825-214169847 CAGGAAGCCTACAATAATGGCGG + Intergenic
1064046654 10:12022943-12022965 GACTAAGCCTGCAATCATGAGGG + Intronic
1065662694 10:28022129-28022151 CACGAAGCCAACAATGAAGAAGG - Intergenic
1071257421 10:83884032-83884054 CAGGAAGCTTACAATAATGACGG - Intergenic
1077133372 11:986162-986184 CACCAGGCTCCCAATAATGAGGG + Intronic
1078917999 11:15798803-15798825 CAGGAAGCTGGCAATCATGATGG + Intergenic
1080596825 11:33780478-33780500 CAAGAAGCCCCCAAAAAAGATGG - Intergenic
1083177194 11:60957937-60957959 CAGGAAGCTTGCAATCATGATGG + Intergenic
1090950981 11:131473183-131473205 TACCAAGCCCCAAATAATGAGGG - Intronic
1092866358 12:12765162-12765184 CAGGAAGCCTCCAATCATGATGG + Intronic
1093098531 12:14999596-14999618 CAAGAAGACCACAAGAATGAAGG + Intergenic
1094002342 12:25708249-25708271 CAGGAAGCTTGCAATCATGATGG - Intergenic
1104602786 12:130164174-130164196 CACGAAGCCCGAGAGGATGAAGG - Exonic
1111221565 13:85211233-85211255 CAGGAAACCTACAATAATGATGG + Intergenic
1112777612 13:102862518-102862540 CACGTAGCCAGCACTAATGAGGG + Exonic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1116681503 14:47976262-47976284 CAGGAAGCCTGCAATCATGGTGG + Intergenic
1124253211 15:28121195-28121217 CAGGAAGCCCACAAAAAGGAAGG + Intronic
1139288139 16:65833602-65833624 CACAGATCCTGCAATAATGATGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1168704119 19:58458719-58458741 CAGGAAGCTTGCAATCATGATGG + Intergenic
925661543 2:6208494-6208516 CAGGAAACCTGCAATCATGATGG - Intergenic
930848667 2:55934289-55934311 CAAAAAGCCCTCAAGAATGAAGG - Intergenic
936031071 2:109070952-109070974 CAGGAAGCTCACAATAATGGTGG - Intergenic
936732398 2:115399970-115399992 CATGAAGCCTCCAATCATGATGG + Intronic
937545360 2:123011007-123011029 CAGGAAGCCCCCAAAAAGGAGGG + Intergenic
941774118 2:169373319-169373341 CCCAAACCCCACAATAATGAGGG - Intergenic
1174417993 20:50380187-50380209 CAGGAAGCCAGCCCTAATGAGGG + Intergenic
1181540762 22:23572082-23572104 CAGGAAGCTTCCAATAATGACGG + Intergenic
1182143184 22:27980317-27980339 AAAGAAGCCAGCAATTATGAGGG - Exonic
952185419 3:30962706-30962728 CTGGAAGCTCGCAATCATGATGG + Intergenic
973198026 4:47467661-47467683 CATGAAGCCCGCCATAAAAAAGG - Intergenic
989784144 5:45307045-45307067 CAAGAACCCCACAGTAATGAAGG + Intronic
990503892 5:56425642-56425664 CCCAAAACCCGCAACAATGATGG - Intergenic
993045288 5:82859423-82859445 CAGTAAGCCCACAATAATGGTGG + Intergenic
1008416578 6:51247743-51247765 CAGGAAGCAAGCATTAATGAAGG - Intergenic
1018367908 6:163140159-163140181 TACGAAGCACGCAGCAATGATGG + Intronic
1029659944 7:101953348-101953370 CAAGAAGCCACCAATTATGAGGG - Intronic
1032167682 7:129558508-129558530 CACGAAGCCCACGTCAATGAGGG - Intergenic
1034931845 7:155169202-155169224 GTAGAAGCCCTCAATAATGAAGG + Intergenic
1058344647 9:103946722-103946744 CAGGAAGCTCACAATAATGGTGG + Intergenic
1186376363 X:9006094-9006116 CAAGGATCCCGCAATAAAGAAGG - Intergenic
1187036246 X:15543194-15543216 CACAAAGCCTTCAATTATGATGG - Intronic