ID: 904862277

View in Genome Browser
Species Human (GRCh38)
Location 1:33547630-33547652
Sequence TCTGTTTCCCACTGTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904862273_904862277 -3 Left 904862273 1:33547610-33547632 CCTAACCACATGTTCTCCATTCT 0: 1
1: 0
2: 1
3: 27
4: 288
Right 904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG 0: 1
1: 1
2: 3
3: 33
4: 315
904862274_904862277 -8 Left 904862274 1:33547615-33547637 CCACATGTTCTCCATTCTGTTTC 0: 1
1: 0
2: 5
3: 54
4: 440
Right 904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG 0: 1
1: 1
2: 3
3: 33
4: 315
904862272_904862277 27 Left 904862272 1:33547580-33547602 CCTAGTCTCGACTCAGACTGTGA 0: 1
1: 0
2: 1
3: 5
4: 109
Right 904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG 0: 1
1: 1
2: 3
3: 33
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904862277 Original CRISPR TCTGTTTCCCACTGTGGAAG AGG Intronic
900489637 1:2941124-2941146 TCTGTAGCCCACTGAGGCAGTGG + Intergenic
902685472 1:18074046-18074068 GCTGTTTCCCTCTGGGGAACGGG + Intergenic
902732125 1:18376520-18376542 TCAGTTTCCCAATGTGTAATTGG + Intronic
903560809 1:24225550-24225572 TCTGTTAACAACTGTGGAGGCGG + Intergenic
904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG + Intronic
905543859 1:38782084-38782106 TCTGTTTCCCATTGTGTCAGTGG + Intergenic
908127405 1:61044695-61044717 TCTGTTTCCCTCCGTGAAATGGG + Intronic
909979195 1:82078090-82078112 TCTTTATTACACTGTGGAAGAGG + Intergenic
910099661 1:83562724-83562746 TCTGATTCCCACTGTAGCTGCGG + Intergenic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
913126153 1:115792264-115792286 ACTGCTTTCCACTGTGGGAGTGG - Intergenic
913317787 1:117567218-117567240 TCTCTTTCCCACTGTGTATATGG - Intergenic
916080231 1:161227635-161227657 GGTGTTCCCCACTGTGGTAGGGG + Exonic
916802620 1:168229067-168229089 TCTGTTTGCCAAAATGGAAGGGG - Intronic
917738173 1:177939044-177939066 TCTGTTTCTCACTGTGTAGCAGG - Intronic
918719533 1:187836097-187836119 TCTGTCTCACACCGTGCAAGAGG - Intergenic
920279296 1:204830726-204830748 TGTGGTTGCCACTGTGGAACAGG + Intronic
921327886 1:214005684-214005706 TCTTTTTCCCCCTGTCGAAAAGG + Intronic
922643872 1:227265151-227265173 TCTTCCTACCACTGTGGAAGTGG - Intronic
923880819 1:238102062-238102084 TCTGTTTCCCATGGGGGAACTGG + Intergenic
923935755 1:238758393-238758415 TCTGTTTCACACTGCTGAAGTGG + Intergenic
924788559 1:247221653-247221675 CATGGTTTCCACTGTGGAAGAGG + Intergenic
924805145 1:247355975-247355997 CATGATTTCCACTGTGGAAGAGG + Intergenic
1064101887 10:12471219-12471241 GCTGATTCCCACTTTGAAAGTGG - Intronic
1064708807 10:18101280-18101302 TCTGTTTCTCACTGTAAAATGGG - Intergenic
1067048405 10:42998756-42998778 TCAGTTTCCCCCTGTAGAACAGG + Intergenic
1071269309 10:83992149-83992171 CCTGCTTCCCACAGGGGAAGTGG - Intergenic
1072227675 10:93385278-93385300 CCTGATTCTTACTGTGGAAGTGG + Intronic
1072543857 10:96419172-96419194 TCAGTTTCCTAATCTGGAAGAGG + Intronic
1072576059 10:96701278-96701300 TCTTTATCTCAGTGTGGAAGAGG + Intronic
1075467287 10:122661243-122661265 TCTGTTTTCCACTGTGGCGGTGG + Intergenic
1075520217 10:123138988-123139010 TCTGTTTCCCACGGTGGAGGAGG - Intergenic
1076295072 10:129377864-129377886 TTTGTTTCCCACAGAAGAAGCGG + Intergenic
1076645372 10:131950460-131950482 TCTGGCTCCCACTGTGGCCGTGG - Intronic
1079019550 11:16897926-16897948 TCTGAATGACACTGTGGAAGTGG - Intronic
1082053005 11:47788109-47788131 ACTGTTTCACACTGAGCAAGAGG + Intronic
1082135005 11:48538171-48538193 TCTTTTCACCACTGTGGCAGAGG + Intergenic
1082316606 11:50733333-50733355 TCTGTTTTCCAATCTGCAAGTGG + Intergenic
1082765610 11:57165223-57165245 TCGGTATCCCTCTGTGGAAGTGG - Intergenic
1083188572 11:61033250-61033272 TCAGTTTCTCACTGTTGGAGTGG - Intergenic
1083706246 11:64518365-64518387 GTTATTTCCCACTGGGGAAGGGG - Intergenic
1084095612 11:66909169-66909191 TCTGCCTCCAGCTGTGGAAGAGG - Intronic
1085414763 11:76312648-76312670 TCTTGTTGCCACTGTGGAGGAGG + Intergenic
1086077537 11:82870459-82870481 TCTGTTTCCCAGTGGAGAAGGGG - Intronic
1086410054 11:86536107-86536129 TCTATTTCCTTGTGTGGAAGGGG + Intronic
1086831662 11:91573288-91573310 TCTGTTTCCCACCTGGGATGTGG - Intergenic
1087129078 11:94653313-94653335 TCTCTTTCCCACAGGGGAATTGG - Intergenic
1088071607 11:105793328-105793350 TCTATTTACCCCTGGGGAAGTGG - Intronic
1088452938 11:110001596-110001618 TGGTTTTCCCACTCTGGAAGTGG + Intergenic
1088659718 11:112033565-112033587 TGAGTTTCCCAATGAGGAAGAGG + Intronic
1089176852 11:116554866-116554888 CCTGGTTCCCCCTCTGGAAGGGG + Intergenic
1089261169 11:117224925-117224947 TCTGTTTTCCACTTTGGAGAGGG - Intronic
1089687623 11:120166830-120166852 TCAGTTTCCTACTGTGTAAAAGG - Intronic
1089754386 11:120675712-120675734 TCTGTTTCCTACTATGAAATGGG + Intronic
1090253059 11:125264427-125264449 TCAGTTTCCCAATTTGCAAGTGG - Intronic
1090440693 11:126722993-126723015 TTTGTCTCCCACGGTGGAATTGG + Intronic
1092131415 12:6115881-6115903 CCTGGTTTCCACTGTGGAAATGG + Intronic
1092183985 12:6464997-6465019 TCTGTTTCCCACTAGAGATGTGG - Intronic
1092999259 12:13980350-13980372 TCTTTTTCCCCCTTAGGAAGGGG - Intergenic
1093512659 12:19947529-19947551 TCTTTCTCTCACTGTGGTAGTGG + Intergenic
1094880393 12:34719090-34719112 TCTGTTTCTAAATGTGCAAGTGG - Intergenic
1094882618 12:34809736-34809758 TCTGTTTCTAAATGTGCAAGTGG + Intergenic
1095349667 12:41193682-41193704 TCTGGTTCCCACTGTATAACTGG - Intronic
1097937424 12:65269414-65269436 TCTGCTTCCCAGTGGGGATGAGG - Intergenic
1099003084 12:77204232-77204254 ACAGCTCCCCACTGTGGAAGGGG - Intergenic
1099419730 12:82442012-82442034 TCTGTATGACACTGTGGTAGTGG - Intronic
1100391362 12:94148569-94148591 TCACTTTCCCATTGTGAAAGTGG - Intergenic
1100572121 12:95852637-95852659 TCTTTCTCCCAGTGTGGTAGTGG - Intergenic
1101056138 12:100916165-100916187 TCCTTTTTCCACTGAGGAAGAGG + Intronic
1101487157 12:105176388-105176410 TCTGTTTGCCACTGTGTATATGG - Intronic
1102289154 12:111685163-111685185 TCAGTTTCCCAATGTGTAAGAGG + Intronic
1102870117 12:116407579-116407601 TCTGTTTTTTACTGTGAAAGAGG + Intergenic
1103522851 12:121547946-121547968 TCTGTTTCCAACTCTGAAAGGGG - Intronic
1105076720 13:16037581-16037603 TCTGTTGCCCATAGTGGAAAAGG + Intergenic
1105634042 13:22200257-22200279 TCTGTGTCACCCTGTGGATGGGG - Intergenic
1106475507 13:30094949-30094971 TCTATTTCCCACAGTGCTAGAGG + Intergenic
1107384640 13:39894680-39894702 TGTGTTTCCCACTGTTGATGGGG - Intergenic
1110405155 13:75142889-75142911 CATGCTTCCCACTGTGGAACTGG + Intergenic
1110500109 13:76217489-76217511 TCAGTTTCCCCATGTGAAAGGGG + Intergenic
1110960013 13:81609458-81609480 ATTGTTTTCCACTGTGGTAGGGG - Intergenic
1112073243 13:95878326-95878348 TCTTCTTTCCACTTTGGAAGTGG - Intronic
1112690612 13:101889573-101889595 TCTATTTCCCAATGTGGAGATGG - Intronic
1115326361 14:32143803-32143825 AATGTTTATCACTGTGGAAGGGG + Intronic
1115954112 14:38758628-38758650 TCTGTTTACCCCTGTGGTAATGG + Intergenic
1115961312 14:38837936-38837958 CCTGCTTCCCTGTGTGGAAGAGG - Intergenic
1116356060 14:43932432-43932454 TCTGTTTCAGAGAGTGGAAGTGG + Intergenic
1118151953 14:63199191-63199213 TCTTTTTTCTACTCTGGAAGTGG - Intergenic
1119729370 14:76941336-76941358 TCTGTTACCGTCTGTAGAAGTGG - Intergenic
1121009225 14:90510114-90510136 TCAGTTTCCTACTCTGAAAGGGG + Intergenic
1121333187 14:93060673-93060695 TCTGGTTAGCACTGGGGAAGGGG + Intronic
1121546381 14:94766776-94766798 TCTGTTTCCCAGGGTGGCTGTGG - Intergenic
1121818503 14:96946349-96946371 GCTGTGTCCCATGGTGGAAGAGG + Intergenic
1122126281 14:99580238-99580260 TCTGTCACCCACTGTGCACGTGG - Intronic
1122126639 14:99581982-99582004 TCGGTTTCCCCCTGGGGAAACGG - Intronic
1122710254 14:103651581-103651603 TCTGTTTCCCTCTGAAGAAGTGG + Intronic
1125106633 15:35979324-35979346 TCTGTTTCCAACTACAGAAGAGG - Intergenic
1125256651 15:37771738-37771760 TCTGCCTCACACTGTGCAAGGGG - Intergenic
1125340307 15:38668950-38668972 TCTGTCAGCCACTGTGAAAGGGG + Intergenic
1125514581 15:40310672-40310694 TCTGTTTCCCAGTCTGGCAAAGG + Intergenic
1125811002 15:42541184-42541206 TCTATTTCTCACTTTGAAAGGGG - Exonic
1127818819 15:62637550-62637572 TCTGTTTTTATCTGTGGAAGGGG + Exonic
1128330344 15:66751506-66751528 TCAGTTTCCCATTGTGGAAGAGG - Intronic
1130545939 15:84857726-84857748 TCTGACACCCACTGTGGAAGTGG + Exonic
1131764116 15:95656811-95656833 TCTGTTCCACACTCTGGAACTGG - Intergenic
1132130417 15:99272308-99272330 TCTGGTGGTCACTGTGGAAGGGG + Intronic
1133505527 16:6408507-6408529 TCTGCTTCCCACCATGGAATGGG - Intronic
1133861081 16:9596122-9596144 CCTTTTTCCCATTGTGGAAAAGG - Intergenic
1135185143 16:20309287-20309309 TCTGTTTCCCAGTGAGTTAGCGG - Intergenic
1135465893 16:22684486-22684508 TCTGTTTCCCACTTGGGAGAAGG - Intergenic
1135751740 16:25063864-25063886 TCTGTTTTTCACAGTGGAGGAGG - Intergenic
1135758356 16:25116587-25116609 TCTCTTTTCCACAGTGGAGGAGG + Intronic
1135908285 16:26535004-26535026 TGGGTTTCTCACTGTTGAAGTGG + Intergenic
1136077196 16:27825263-27825285 CTTGTTTCCCACTGTGGACCAGG - Intronic
1137238880 16:46638118-46638140 TCTGTCTCCCACTGAGGATGAGG + Intergenic
1138506309 16:57479966-57479988 TCTGGCTCCTACTGTGGAGGTGG + Intronic
1139464096 16:67144920-67144942 TCTGTTTTCCACTATGAAAAGGG + Intronic
1139520766 16:67481485-67481507 TCAGTTTCCCTCTGGGGAGGAGG - Intergenic
1140038940 16:71392615-71392637 TCTGTTTCCCTCTGACAAAGAGG + Intergenic
1140882461 16:79211293-79211315 TCTTTTTCTCTGTGTGGAAGAGG + Intronic
1141640691 16:85339297-85339319 TCCTTTTCCTCCTGTGGAAGGGG + Intergenic
1142036068 16:87862744-87862766 CCTGTTTCTGACTGTGGAATGGG - Intronic
1142592739 17:1013441-1013463 TCTGTTACCCACCGTGGGGGAGG + Intronic
1143577644 17:7803936-7803958 TCTGTTTCCCACTGTGGAACAGG - Intronic
1143651595 17:8266961-8266983 TCCCTCTCCCACTGTGGAGGGGG + Intronic
1144028350 17:11298284-11298306 TGTGTGTCCCACTCTTGAAGTGG - Intronic
1145260190 17:21349952-21349974 TCTGTGTCCAGCTGTGTAAGAGG - Intergenic
1145305015 17:21669188-21669210 TCTGTTTCCTCATGTGCAAGTGG + Intergenic
1145714855 17:27009893-27009915 TCTGTGTCCAGCTGTGTAAGAGG + Intergenic
1147137421 17:38442297-38442319 TCTGGTTCCCTCTGAGGAAGGGG + Intronic
1147345882 17:39794712-39794734 TCTGTTTCCTACTTGGAAAGAGG + Intronic
1147353193 17:39868255-39868277 TCTGCTCCGCACTGTGGAGGAGG + Exonic
1148896206 17:50840596-50840618 GCTGGTTCCCCCTGGGGAAGGGG - Exonic
1149247166 17:54723462-54723484 TCTGAATCCGACTGTGGAAAGGG - Intergenic
1150016174 17:61559695-61559717 TCAGTTTCTCATTGTGGAATTGG - Intergenic
1151646385 17:75435175-75435197 AATGTCTCCCACTGTGGAAAGGG + Intergenic
1153731208 18:8013693-8013715 TCTGTTGGCCACTGTGAAGGAGG + Intronic
1154020840 18:10662901-10662923 TCAGTTTCCCAGAGTGGAGGAGG - Intergenic
1156386434 18:36609403-36609425 TCTTTTTCCAGCTGTGCAAGAGG - Intronic
1157482597 18:48065072-48065094 TCTGCCTCCCACTGAGGAAGAGG + Intronic
1157873235 18:51249086-51249108 TGTTTTTCCCAGAGTGGAAGTGG + Intergenic
1160235754 18:77085412-77085434 TTTCTCTCCCACTGTGGAATAGG + Intronic
1161348855 19:3781445-3781467 TCAGTTTCCCCCTCTGGAACAGG - Intronic
1161757879 19:6147826-6147848 TCAGTTCCTCTCTGTGGAAGCGG + Intronic
1162150716 19:8643607-8643629 TCTGTGTCAAACTGTGGAATAGG + Intergenic
1162197725 19:8998579-8998601 TCTGTTGCCCAGTCTGGAACTGG - Intergenic
1163004162 19:14387147-14387169 TCAGTTTCCCTCTGTAGAATAGG - Intronic
1165613568 19:37178507-37178529 TCTGTTTCCATCTGTGAAATAGG - Intronic
1165982248 19:39734675-39734697 TCAGTTTCCATCTGTGGATGAGG - Intronic
1166404733 19:42511994-42512016 TCTGTTGACCACATTGGAAGAGG - Intronic
1166913234 19:46176252-46176274 TTTGTTCCTCTCTGTGGAAGAGG - Intergenic
1167402655 19:49283199-49283221 TCTGGTTCCAGCTATGGAAGGGG + Intergenic
925371447 2:3348591-3348613 TCTGTTTCCTCCTGTGGGACAGG - Intronic
925780961 2:7381467-7381489 TCTGTTAGCCACTGTGCTAGAGG - Intergenic
926163383 2:10503411-10503433 TCTGGTTCCCATGGTGGCAGGGG + Intergenic
930180432 2:48350503-48350525 GCTGTCTGCCACTGAGGAAGAGG - Intronic
930317186 2:49811928-49811950 TCTGATTTCCACTCTGGAATTGG - Intergenic
931811934 2:65862670-65862692 TCTCTTTTCCATTGTGGAACTGG + Intergenic
932479736 2:72032000-72032022 CCTGTTACCCACAGTGCAAGGGG + Intergenic
933590163 2:84224157-84224179 TCTGTTTCCCTCCCTGGAATAGG + Intergenic
934490122 2:94756635-94756657 TCTGCTTCCCAGTGGGGAAGGGG + Intergenic
935448427 2:103181377-103181399 GCGTTTTCACACTGTGGAAGGGG + Intergenic
937390348 2:121480625-121480647 TCTGTTTCCCTGTGTGAAAAAGG + Intronic
937819774 2:126296643-126296665 TGGGTTTCTCACTGTTGAAGTGG + Intergenic
938072460 2:128315931-128315953 TCTGCCACCCACTCTGGAAGTGG - Intronic
940128371 2:150353590-150353612 TTTGTTCCGTACTGTGGAAGTGG - Intergenic
940740347 2:157500435-157500457 TCTGTGGCCCAATGGGGAAGAGG + Intergenic
942305781 2:174606465-174606487 TGTGTTGCCCAGTGTGGTAGTGG - Intronic
942331825 2:174833911-174833933 TGTGGTTCCCACTGCGTAAGAGG - Intronic
942366180 2:175230267-175230289 TCTGTTTCTCAGTGTACAAGAGG - Intergenic
944879256 2:203994681-203994703 TCAGTTTCCTGCTCTGGAAGTGG + Intergenic
947701215 2:232235971-232235993 TCTGTTTCCCACAGAGGAGAGGG - Intronic
948192422 2:236070173-236070195 TCAGTTTCCTCCTCTGGAAGTGG + Intronic
948614514 2:239190069-239190091 TGTTTTTCCCACAGTGGATGTGG - Exonic
1169030664 20:2404374-2404396 TCCCTTTCCCACTGTGTAACAGG + Intronic
1172048863 20:32101178-32101200 TCTGTCTTTCACAGTGGAAGGGG + Intronic
1172619218 20:36308139-36308161 CCTGTCTCCCGCTGTGGCAGGGG + Intronic
1173549199 20:43920719-43920741 TCTGTTTCCCTGTGTGCAAAGGG + Intronic
1173670543 20:44795761-44795783 TCTGTTTCTCTCTGTGTAAAAGG - Intronic
1174303677 20:49600324-49600346 TCTGTTCCCATCTGTGCAAGAGG - Intergenic
1175229719 20:57466043-57466065 TCAGTTTCCCCCTGTGAAATGGG - Intergenic
1175398231 20:58682533-58682555 TCAGTTTCCCCCTCTGGAAAAGG - Intronic
1176005220 20:62858608-62858630 TCAGTTTCCCAGGGAGGAAGGGG + Intronic
1178639359 21:34333771-34333793 ACTGGCTCCCACTGTGGCAGGGG + Intergenic
1181721001 22:24774407-24774429 TATTTTTCCATCTGTGGAAGTGG - Exonic
1181909276 22:26225603-26225625 TGTGTTCCCCACTGAGAAAGAGG + Intronic
1184527802 22:45035797-45035819 TCTGTTTCCCTTTTTGGAAAAGG + Intergenic
1185019535 22:48366162-48366184 TCTGTTGCTCACTGTGGGTGCGG + Intergenic
949437148 3:4041793-4041815 TCTGTTTCTCTCTGTGAAAAAGG - Intronic
949555326 3:5147614-5147636 CATGGTTTCCACTGTGGAAGAGG - Intronic
949981750 3:9506331-9506353 TCTTTCTCCCTCTGTGGAAGTGG - Intronic
950799997 3:15542903-15542925 TCTGTTGCCCACTGGAGAACTGG - Intergenic
952820931 3:37485066-37485088 TCTGTTTTCCCCTGTAGATGGGG - Intronic
953784683 3:45902264-45902286 TCTGTGTCCCCTTTTGGAAGAGG - Exonic
953879895 3:46686190-46686212 TCAGTTTCCCTATATGGAAGGGG - Intronic
953888826 3:46735604-46735626 TCAGTTTCTCACTGTGAAATGGG + Intronic
954662776 3:52234907-52234929 TCAATTTCCCACTCTGGAAATGG - Intronic
954812201 3:53255382-53255404 TCCGTTTCCCCATCTGGAAGGGG + Intronic
954832127 3:53430423-53430445 TCTGTTTCCCTCTTTGAAGGAGG + Intergenic
955176021 3:56613474-56613496 TTGGTTCCCCTCTGTGGAAGAGG + Intronic
955753092 3:62202679-62202701 ACTGTCTCCCAGTGAGGAAGTGG - Intronic
956250550 3:67230177-67230199 TCTGGTCCCAACTATGGAAGAGG - Intergenic
957441657 3:80255549-80255571 TCTGCTTCACACTCTGCAAGGGG + Intergenic
957465908 3:80590270-80590292 TCTCTTTCACACTCTGGATGAGG - Intergenic
957943885 3:87038035-87038057 TCTGGTCCCTACTGTGGAAGGGG - Intergenic
958598402 3:96260504-96260526 TCTGATTTCCTCTGGGGAAGGGG + Intergenic
960043700 3:113175775-113175797 TCAGTTTCCCTGTGGGGAAGGGG + Intergenic
961448802 3:126993187-126993209 TCAGTTTCCCTCTGTGGGACTGG - Intronic
961751511 3:129098078-129098100 TCTGTTCTCAACTCTGGAAGGGG - Intronic
962623995 3:137207224-137207246 CCGGGTTACCACTGTGGAAGTGG - Intergenic
963003954 3:140708516-140708538 TGTGTTCCCCACTGGGGAAGGGG - Intergenic
964316043 3:155445169-155445191 CCTCTTTCCCACAGTGGGAGTGG + Intronic
965055290 3:163705239-163705261 GCTACTTTCCACTGTGGAAGTGG - Intergenic
966385466 3:179393055-179393077 TTTCTTCCCCACTGTGGAAGAGG + Exonic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969672067 4:8595353-8595375 TCTGTGTCCCACGGTGGTTGGGG + Intronic
970024664 4:11610709-11610731 TCTGTTTGCAACTGGGCAAGAGG + Intergenic
970826442 4:20281569-20281591 TTTCTTTCCCTCTGTTGAAGGGG + Intronic
972101748 4:35428766-35428788 TCTTTTTCTCTCTGTTGAAGTGG + Intergenic
972151320 4:36094549-36094571 TGTGTTTGGCACTGTGGTAGAGG + Intronic
973285215 4:48408289-48408311 TCTGTTGCCCAAGCTGGAAGTGG - Intronic
973553395 4:52057643-52057665 TCTGTTTCCCTCTGTTTAGGAGG - Intronic
973650017 4:52989655-52989677 TATGTTTCCCACTGTGGCATTGG + Intronic
973713204 4:53649815-53649837 TCTGCTTCCCACAGTGGACTGGG + Intronic
974148333 4:57973462-57973484 TCTGCCCCCCACTGTGGAATGGG + Intergenic
974552537 4:63396593-63396615 AATGTTTCCCAGTGTTGAAGAGG - Intergenic
975280357 4:72555170-72555192 TCTGTTTTCTACTTTTGAAGTGG - Intronic
975365691 4:73524855-73524877 TCTGCTTTCCACTGTGATAGTGG + Intergenic
975993216 4:80282540-80282562 ACTGTTTTCCACTGTAAAAGTGG + Intronic
979792434 4:124802271-124802293 TTTGTAGCCCACTTTGGAAGAGG - Intergenic
980274406 4:130630899-130630921 TATGTTTCTCACTGTTGGAGTGG + Intergenic
982506570 4:156226303-156226325 TCCGTTTCCATCTGTGGAATGGG + Intergenic
982527363 4:156495985-156496007 TCTGTTTCCCACAGTTGAGAAGG - Intergenic
983285509 4:165735051-165735073 TCAGTTTCCTACTCTGAAAGAGG + Intergenic
984653403 4:182292640-182292662 TCTCTTTCCCTCTCTGAAAGTGG + Intronic
984995516 4:185426457-185426479 TCTGTTTCCCAGAGAGGAAACGG - Intronic
985988573 5:3537289-3537311 TTTGTTTCCCTCTGTGAAACTGG - Intergenic
986148000 5:5098396-5098418 TCTGTTACTCAGTGGGGAAGAGG + Intergenic
987117599 5:14738046-14738068 TCTTCTGCCCAGTGTGGAAGAGG - Intronic
987324342 5:16798875-16798897 TCTGCTTGCAACTGAGGAAGAGG - Intronic
987879373 5:23722363-23722385 TATGTTTCACACTATGGTAGGGG + Intergenic
989859140 5:46343448-46343470 TTTGTTTCCCATGGTGGAAAAGG - Intergenic
990775265 5:59299365-59299387 CCTGTTTCCCTCTGTGGGAACGG + Intronic
991616950 5:68506770-68506792 TCACTTTCCCACTTTGAAAGAGG - Intergenic
992085879 5:73278072-73278094 TCTGTTTCCCCAATTGGAAGAGG - Intergenic
992917802 5:81477457-81477479 CGGGTTTCCCACTGTTGAAGAGG - Intronic
994415174 5:99460561-99460583 TATGTTTCTCACTGTCGGAGTGG + Intergenic
994584181 5:101684523-101684545 TATGTTTTTCACAGTGGAAGAGG - Intergenic
995542795 5:113201028-113201050 GCTTTTTCCCCCTGTGTAAGGGG - Intronic
996166402 5:120229011-120229033 TCTGTTCCCCATTGTCGAGGGGG + Intergenic
996397335 5:123026493-123026515 TCTGTTTCCCATTGTAAAATAGG - Intronic
996565479 5:124875691-124875713 TTTCTTCCCCACTGTGGAAGAGG - Intergenic
996776858 5:127142184-127142206 ACTGTTTTCCACAGTGGAAATGG - Intergenic
997064794 5:130547862-130547884 CATGGTTTCCACTGTGGAAGAGG - Intergenic
997091382 5:130863162-130863184 CCTGATTCCCACTGAGGAGGTGG - Intergenic
997599011 5:135126853-135126875 TCTGTTTCCCTCTGATGAAGGGG + Intronic
998173791 5:139887815-139887837 TCTGTTTCCCCATCTGTAAGTGG - Intronic
998601858 5:143592726-143592748 TCTCCTTCCCACAGTGGGAGAGG + Intergenic
999142834 5:149374038-149374060 TCTGTCGCCCAGGGTGGAAGTGG - Intronic
999142994 5:149374956-149374978 TCTGTCACCCAGGGTGGAAGTGG + Intronic
1000237545 5:159376532-159376554 TCTGTTCCCCACAGTGGCTGAGG + Intergenic
1001956238 5:175849956-175849978 TCTGTTTCCCACTGAATCAGGGG + Intronic
1002777479 6:341399-341421 GGTATTTCCCACTGTGGAGGAGG + Intronic
1003065680 6:2902244-2902266 TCTGATTCCCACCCTGGAGGAGG + Intronic
1003140901 6:3470404-3470426 TCTATTGTCCTCTGTGGAAGAGG - Intergenic
1003437561 6:6106049-6106071 TCTATTTCTCTCTGTGAAAGTGG + Intergenic
1004150940 6:13119622-13119644 TCTGCTTCCTACTGAGGAGGAGG + Intronic
1004451071 6:15747164-15747186 TCTGTTTCCCATTGGGGTAATGG + Intergenic
1006555070 6:34858975-34858997 TCTCTTTCCCAGTGCTGAAGTGG + Exonic
1006586900 6:35121043-35121065 TCTCTTTCCCCCTGTGTCAGAGG - Exonic
1007114770 6:39335730-39335752 TATGTTTTTCCCTGTGGAAGTGG + Exonic
1008051831 6:46908109-46908131 CCAGTTTTCCACTGAGGAAGAGG - Intronic
1009884999 6:69615616-69615638 TCTGGTCCCAACTATGGAAGGGG - Intergenic
1010258412 6:73787320-73787342 TCTGGTTCCCAGTGAGGATGGGG + Exonic
1010819809 6:80400390-80400412 TCTGTTGCCCACTTTGTAATGGG - Intergenic
1011561781 6:88626068-88626090 TCTGTTTCCCTCTGTGAAATGGG - Intronic
1012612858 6:101236969-101236991 TCAGTTTCTCACTGATGAAGAGG + Intergenic
1014415057 6:121173537-121173559 TCTGTTTTCAACAGTGGAAATGG + Intronic
1015381256 6:132571948-132571970 TCTGCTTCCCACTTTGGGGGAGG - Intergenic
1015470483 6:133599900-133599922 TGTGTTTCCCAGTGTGGCTGAGG - Intergenic
1015840634 6:137473320-137473342 TCTGTTTCCTACAGCAGAAGAGG + Intergenic
1016264566 6:142215874-142215896 TCTCTTTGCCACTGTAGTAGAGG + Intronic
1017918708 6:158853477-158853499 TCTGTGACTCACTGTGGGAGGGG - Intergenic
1018844218 6:167543996-167544018 TCTGTTTTCCCCTGTGGTAGAGG - Intergenic
1020591720 7:10147405-10147427 TTTATTTCCCACTGTAGAAGAGG - Intergenic
1020750045 7:12129452-12129474 ACTGTTTTCCTCTGTGAAAGGGG - Intergenic
1021182044 7:17518281-17518303 TCAGTTTCTCATTATGGAAGAGG + Intergenic
1021218468 7:17945742-17945764 TCAGTTTCTCACTGTTGAAGTGG - Intergenic
1021517810 7:21506565-21506587 CATGGTTTCCACTGTGGAAGAGG - Intronic
1021744605 7:23726097-23726119 TCTGATTCCCAATGTTGGAGGGG - Intronic
1021801953 7:24316184-24316206 TTTGTCTCCCTCTGTAGAAGGGG - Intergenic
1023925233 7:44664171-44664193 ACTGTTCCCCACTGTGGTGGGGG + Intronic
1024165025 7:46722470-46722492 ACTGTTTCCCTGAGTGGAAGAGG - Intronic
1026867520 7:73832701-73832723 TCTGATTTCAACTGTGGAGGTGG + Intergenic
1027422312 7:78029061-78029083 TATGTGTCCCAATGTGGAAAAGG - Intronic
1027980889 7:85220398-85220420 TTTGTTTCCCCCTGGGGAAGAGG - Intergenic
1028057158 7:86260398-86260420 TTTGTTGCCCTCTGTGGAAATGG + Intergenic
1028187051 7:87799307-87799329 TCTCTTTACTACTTTGGAAGAGG - Intronic
1028306075 7:89266656-89266678 TCTATTTCCCTCTGTGAAATCGG + Intronic
1028333118 7:89621719-89621741 TCTGTTTCCCACTGTAGCTGTGG - Intergenic
1029049486 7:97669687-97669709 TTTGTTTCCCACTCTAGAATGGG + Intergenic
1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG + Intronic
1029638858 7:101805386-101805408 TCAGTTTCCCCCTGTGTAAAAGG + Intergenic
1030715494 7:112803035-112803057 TCTGGTCCCAGCTGTGGAAGGGG - Intergenic
1032739758 7:134727095-134727117 CTTGCTTCCCACTGTAGAAGTGG - Intergenic
1033161093 7:138997600-138997622 TCTGTTTCCAACGCTGGCAGCGG + Intergenic
1033242505 7:139691758-139691780 TCAGTTTCCACCTGTGCAAGTGG + Intronic
1033251702 7:139766179-139766201 TCTGTGTAACACTGTGGAAGTGG + Intronic
1033562135 7:142542355-142542377 TCTGTTTCTCTCTGAGGACGAGG + Intergenic
1033581122 7:142736747-142736769 TCTGTTTTTCCCTGTGGAAATGG - Intergenic
1034434943 7:151059126-151059148 TCTCTGTCCCTCTCTGGAAGTGG + Exonic
1034594829 7:152179999-152180021 TCTGGTTGCCAGTGTTGAAGAGG + Exonic
1035140526 7:156755299-156755321 TACTTTTCCTACTGTGGAAGGGG + Intronic
1036492798 8:9243518-9243540 GCTGCTTCCCAATGTGGAAAGGG + Intergenic
1036821993 8:11948278-11948300 TCTCTTTCTCTCTGTGTAAGTGG - Intergenic
1039971096 8:42322380-42322402 ACTGTTGCCCAAGGTGGAAGAGG + Exonic
1041330453 8:56718807-56718829 GCTGTTGCTCACTGAGGAAGAGG - Intergenic
1041617685 8:59927445-59927467 TCAGTTTCCCCATGTGGAAAAGG + Intergenic
1042900175 8:73717487-73717509 ATTGTTTCCAACTGTGGAAAAGG + Intronic
1043941876 8:86205236-86205258 TGTGATTCCCAATGTGGAGGTGG + Intergenic
1044411297 8:91886414-91886436 GCTGTTTTCCACTTTGGAAGTGG - Intergenic
1044533908 8:93338413-93338435 TTTGTTTCCCCCTTTGCAAGAGG + Intergenic
1045063203 8:98425801-98425823 TGTACTTCCCACTGTGGCAGTGG + Intronic
1048946582 8:139454025-139454047 TCTGCTTCCCACTGAGGATGAGG + Intergenic
1049269263 8:141685520-141685542 CCTGTTTTCCACTGTGTAAATGG - Intergenic
1049494174 8:142922050-142922072 TCAGTTTCCTCCTGTGGAATGGG - Intergenic
1050257259 9:3808133-3808155 TCTTGTTCCCACTGTGATAGAGG + Intergenic
1051026255 9:12615314-12615336 TGTGTTCCTCACTGTGGAAGTGG + Intergenic
1051589752 9:18765575-18765597 TTTGTTTCCCAGTAAGGAAGTGG - Intronic
1052834668 9:33241515-33241537 TCTGTTTCCAGCTGGGGAAATGG - Intronic
1053917463 9:42954181-42954203 TCTGCTTCCCAGAGGGGAAGGGG - Intergenic
1056577023 9:87863261-87863283 CCTTTTTCCCACTGAGGAAATGG + Intergenic
1057206072 9:93173399-93173421 TCCGTGTCCCCCTGTGGAAATGG + Intergenic
1057745279 9:97746136-97746158 TCTGTCTCCTAAGGTGGAAGAGG - Intergenic
1057753510 9:97810816-97810838 TGTGCTTCCCACAGTGGAAAAGG + Intergenic
1059486437 9:114630747-114630769 TCTGTTTGCCAGTGAGGAAACGG + Intronic
1059817005 9:117927831-117927853 TTTGTTTGCCCCTGTGCAAGGGG + Intergenic
1060384007 9:123205771-123205793 ACAGTTTCCAACTGTGGCAGAGG - Intronic
1060977393 9:127772798-127772820 TCAGTTTCCCAATCTGTAAGTGG + Intronic
1062694722 9:137867566-137867588 CCTGTTTACCTCTGTGGTAGAGG + Intronic
1062703267 9:137919240-137919262 TCTGCTCACCACTGTGTAAGCGG - Intronic
1186944890 X:14554801-14554823 TCCTTCCCCCACTGTGGAAGAGG - Intronic
1187260566 X:17681937-17681959 TTTGTTCCCCACTATGGATGAGG - Intronic
1187941575 X:24387812-24387834 TCTGCATCTCACTGAGGAAGTGG - Intergenic
1188642837 X:32527881-32527903 TGTGTCTCCCTCTGTGGAAGGGG + Intronic
1192178601 X:68901509-68901531 TCTGTTTCCCACTATACAACTGG - Intergenic
1195162201 X:102181772-102181794 TCTGTTTCTCCCTATGGCAGGGG + Intergenic
1195747162 X:108130295-108130317 TTCTTTTCCCAGTGTGGAAGTGG - Intronic
1195997749 X:110748054-110748076 TCTTTCTCCCCCTTTGGAAGTGG + Intronic
1196064244 X:111445199-111445221 TTTCTATCCCGCTGTGGAAGAGG - Intergenic
1196167745 X:112553984-112554006 TCTTTTTCCCCCTTTGGCAGAGG + Intergenic
1196324677 X:114389193-114389215 TCTGTTTTCCACAGTGGAATTGG - Intergenic
1196367949 X:114944076-114944098 TCTGTTTGTCCCTGTAGAAGAGG + Intergenic
1199923086 X:152430289-152430311 CCTGTTTCCCAGTGGGTAAGTGG - Intronic