ID: 904863754

View in Genome Browser
Species Human (GRCh38)
Location 1:33560406-33560428
Sequence AGGGGGAATCAGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904863754_904863766 25 Left 904863754 1:33560406-33560428 CCTGCATCCCTCTGATTCCCCCT 0: 1
1: 0
2: 4
3: 38
4: 343
Right 904863766 1:33560454-33560476 ATTTGGCTGCACTGGCCTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 142
904863754_904863765 17 Left 904863754 1:33560406-33560428 CCTGCATCCCTCTGATTCCCCCT 0: 1
1: 0
2: 4
3: 38
4: 343
Right 904863765 1:33560446-33560468 CTCACTCTATTTGGCTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 126
904863754_904863764 8 Left 904863754 1:33560406-33560428 CCTGCATCCCTCTGATTCCCCCT 0: 1
1: 0
2: 4
3: 38
4: 343
Right 904863764 1:33560437-33560459 GTGGTATAGCTCACTCTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 76
904863754_904863767 28 Left 904863754 1:33560406-33560428 CCTGCATCCCTCTGATTCCCCCT 0: 1
1: 0
2: 4
3: 38
4: 343
Right 904863767 1:33560457-33560479 TGGCTGCACTGGCCTCTTGGAGG 0: 1
1: 0
2: 3
3: 25
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904863754 Original CRISPR AGGGGGAATCAGAGGGATGC AGG (reversed) Intronic
900113443 1:1019339-1019361 AGGGGGAAACTGAGGGCTGGAGG - Intergenic
900857589 1:5198398-5198420 AGGATGGCTCAGAGGGATGCAGG - Intergenic
902169353 1:14598332-14598354 AGGGGGCCTCAGAGGGGAGCCGG - Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902720207 1:18299069-18299091 TGGGGAAATCAGGGTGATGCTGG + Intronic
903050311 1:20595562-20595584 AGGGGGAAACAGCGGGAAACGGG - Intronic
904215499 1:28915210-28915232 AGGCGGAATCTGAGGACTGCAGG + Intronic
904286197 1:29454590-29454612 AGGGTGAAGCAGGGGGAAGCAGG + Intergenic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905362313 1:37429609-37429631 AGGGGGAGAAAGAGGGATGGGGG - Intergenic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909386950 1:75068466-75068488 AGTGGGATTCAGAAGAATGCAGG - Intergenic
909923844 1:81414970-81414992 AGGAGAAATCACAGAGATGCAGG - Intronic
910624572 1:89292808-89292830 AGGTGTGATCAGAGGAATGCTGG + Intergenic
914970240 1:152303324-152303346 AGGGTGAATCAGCGGGGTCCAGG - Exonic
914970561 1:152305268-152305290 AGGGACAATCAGAGGGGTCCAGG - Exonic
914970713 1:152306240-152306262 AGGGACAATCAGAGGGGTCCAGG - Exonic
914971656 1:152312075-152312097 AGGGACAATCAGAGGGGTCCAGG - Exonic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915628861 1:157136816-157136838 AGTGGGAATCAGATGGATTTGGG - Intronic
915911218 1:159916830-159916852 AGGGGGAATTTGAGGGACGCTGG - Intergenic
917626946 1:176855893-176855915 TGGGGGCATCAGAGGGAGACTGG + Intergenic
918629462 1:186698959-186698981 AAAGGGAATCAAGGGGATGCTGG + Intergenic
919651497 1:200153798-200153820 AGGGGGAGATAGAGGGATGGAGG + Intronic
919922068 1:202171882-202171904 AGGGGGCACCAAAGGGCTGCAGG + Intergenic
920803012 1:209207199-209207221 AGGAGGAAGCAGAGGGCTTCAGG + Intergenic
920820319 1:209374285-209374307 AGGGGGTATCAGAGGGCTTTAGG - Intergenic
921177556 1:212607813-212607835 AGGAGGAATCAGAGGCAACCCGG - Intronic
921856348 1:219989641-219989663 AATGGGCATCAGAGGAATGCAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922784978 1:228278244-228278266 AGGGCTAATCAGAGGTATGCGGG + Intronic
923685905 1:236153776-236153798 AGGGGGACTCACAGAGATGAAGG - Intronic
923836928 1:237621881-237621903 AGGGGCAGACAGAGGGATGTGGG + Intronic
924140038 1:241012747-241012769 AGGGGGACTCAGAGAGAGCCTGG - Intronic
924455695 1:244217328-244217350 AGGAGGAAACCGAGGGTTGCTGG - Intergenic
1062815298 10:495223-495245 AAGGGGAAACAGGGAGATGCTGG + Intronic
1062987069 10:1778981-1779003 AGGGATAACCAGAGGGAAGCTGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064077662 10:12282652-12282674 AGGGGGAATGGGTGGGATGGGGG - Intergenic
1068961433 10:62870432-62870454 AGGAGGCATGAGAGGGCTGCAGG + Intronic
1069029139 10:63577269-63577291 GGGGTGAATCAGAGGGTTTCTGG - Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1071531693 10:86394626-86394648 AGAGGGAACCATAGGGAAGCTGG - Intergenic
1073128465 10:101168321-101168343 AGGGGGAATATGAGCGATGATGG - Intergenic
1073479803 10:103779371-103779393 CGGGGGTATCAGGAGGATGCTGG - Intronic
1073632386 10:105161827-105161849 AGGTGGAATCAGAGAGATTGTGG - Intronic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1075661620 10:124200870-124200892 AGCGGGATTGAGAAGGATGCAGG + Intergenic
1076642927 10:131931108-131931130 AGGGGAGAGGAGAGGGATGCTGG - Intronic
1078267683 11:9767030-9767052 AGGGGGACTGGGAGGGAGGCAGG - Intergenic
1080036856 11:27719772-27719794 AGGGGGAAAGAGAGGGAGGGAGG + Intronic
1081401265 11:42645644-42645666 AGGGGGCAGCAGTGGCATGCTGG + Intergenic
1081680202 11:44997145-44997167 AGGGGGCAAAAGAGGGAAGCAGG + Intergenic
1083731108 11:64653254-64653276 AGGGGGAAGGCGAGGGATGCAGG - Intronic
1084738428 11:71121187-71121209 TGGGGGAATCAGAGGACTGCTGG - Intronic
1086762638 11:90652122-90652144 AGGGGGATTAAGAGAGATGGAGG - Intergenic
1088182322 11:107126828-107126850 AGGGGGAAGGAGAGTGAAGCTGG - Intergenic
1089187677 11:116631292-116631314 AGAGGGAAGCAGAGGGTGGCTGG - Intergenic
1089604187 11:119632202-119632224 AGTAGGAATCAGAGGGCTCCAGG + Intronic
1089643766 11:119864662-119864684 AGGGGGAAGCCGAGGCATGAGGG - Intergenic
1091588000 12:1827091-1827113 AGGGCGAAGGAGAGGGGTGCGGG + Intronic
1093741463 12:22693707-22693729 CGGGGGAAAAAGAGGGATGGGGG - Intergenic
1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG + Intronic
1096372716 12:51082853-51082875 AGCAGGAATCAGAGGGAAGTGGG - Intronic
1096756254 12:53802381-53802403 AGGGGCAACCATAGGGATCCAGG + Intergenic
1096838639 12:54367977-54367999 GGGAGGATTCAGAAGGATGCGGG - Intergenic
1097132247 12:56820663-56820685 AGGGGGTATCAGAAGGGTACAGG + Intergenic
1097189325 12:57212015-57212037 AGGGTGAGTCACAGGGATTCTGG + Exonic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1099192751 12:79577070-79577092 ATTTCGAATCAGAGGGATGCTGG - Intronic
1100125534 12:91420411-91420433 AGGGGGAATCTGAGTAATTCTGG - Intergenic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101059806 12:100959089-100959111 AGGGGGGTTGAGAGGGATGAGGG - Intronic
1101355061 12:103969058-103969080 AGGCAGCATCAGAAGGATGCTGG + Intronic
1102082150 12:110107114-110107136 TGGGAGAATGAGAGGGTTGCTGG + Intergenic
1102292125 12:111709600-111709622 AGATGGACTCAGAGGGCTGCAGG - Exonic
1102956733 12:117063730-117063752 AAGGGGAATCAGAGGGGCACTGG - Intronic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1104404896 12:128509054-128509076 AGTGGGAATCAGAAGGATGTTGG + Intronic
1104681456 12:130754861-130754883 AGCAGGAACCAGAGGGAAGCAGG + Intergenic
1104998627 12:132674581-132674603 AGGGGGAGGCCCAGGGATGCTGG - Intronic
1107599001 13:41993486-41993508 AGGGGGACTCATAGGTAGGCTGG - Intergenic
1109434798 13:62284992-62285014 AGTGGGAATGAGAGAGATGATGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1113082024 13:106530245-106530267 GGGGGGAATTAGAAGGAGGCTGG - Intronic
1114181031 14:20368060-20368082 AGGAGGAATGAGAGTGATGTTGG - Exonic
1114416261 14:22546518-22546540 AGGAGGAAACAGAGGTTTGCCGG - Intergenic
1115470371 14:33762624-33762646 AGCGGGAATCAGTGGTATGGAGG + Intronic
1118532680 14:66724547-66724569 AGGGGTAGATAGAGGGATGCAGG + Intronic
1119144929 14:72303533-72303555 TGGGGGAATCTAAGGGAAGCTGG - Intronic
1119628388 14:76203596-76203618 GGGGTGACTCAGAGGCATGCTGG - Exonic
1119689603 14:76661256-76661278 AGAGGGAAGCAGAGGGAGACTGG - Intergenic
1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG + Intronic
1121697842 14:95927940-95927962 AGGGAGAAGGAGAGGGATGGAGG - Intergenic
1121777794 14:96602170-96602192 AGGGGGGATTGGAGGGCTGCAGG + Intergenic
1122097196 14:99380815-99380837 ATGGGGAATCTGAGGGCTCCTGG - Intergenic
1124533057 15:30522925-30522947 AGGTGGACTCAGATGGGTGCTGG + Intergenic
1125223065 15:37362495-37362517 AGTGGGTATCAGAGTGATGCAGG + Intergenic
1126243340 15:46472118-46472140 AGAAGGAATCAGAGGAATGATGG + Intergenic
1126744139 15:51807823-51807845 AGGTGGAAGAAGAGGGTTGCAGG + Intronic
1127620046 15:60725232-60725254 AGTGGGAAAGAGAGGGGTGCTGG - Intronic
1129231173 15:74197924-74197946 AGGAGGGATCAGAGGGTTGAGGG - Intronic
1129298148 15:74611052-74611074 AGGGAGAATCTGAGGGAGGGAGG - Intronic
1129576956 15:76759945-76759967 ATTTGGAATCAGAGTGATGCTGG + Intronic
1131467618 15:92668089-92668111 AGGGGGAATGGGAGGGAGGGAGG + Intronic
1131662967 15:94538496-94538518 AGGGGACATCAGAGGTAGGCTGG + Intergenic
1131838465 15:96413105-96413127 AGTGAGAATCAGAGAGATGCAGG - Intergenic
1132094038 15:98968945-98968967 AGAGGGATTCACTGGGATGCAGG - Intronic
1133368281 16:5228432-5228454 AGTGGGAGTGAGAGGGATGGAGG + Intergenic
1134861888 16:17567609-17567631 GGGGGGGATGGGAGGGATGCAGG + Intergenic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1136784320 16:32925700-32925722 TGGGGGGATCAGAGCGATCCGGG + Intergenic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1138658972 16:58506857-58506879 AGGGGCAGACAGAGGGACGCAGG - Intronic
1140324038 16:73982680-73982702 AGGGGCAATCAGAGACAGGCAGG + Intergenic
1141386212 16:83624510-83624532 ACTGGGAATGAGAGGGATCCAGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141431701 16:83973505-83973527 AGGAGGAATAAGAGGGACGTAGG + Intronic
1141783549 16:86181982-86182004 AGTGGGAGGCACAGGGATGCTGG - Intergenic
1203086977 16_KI270728v1_random:1189706-1189728 TGGGGGGATCAGAGCGATCCGGG + Intergenic
1143286538 17:5794056-5794078 AGGGGGCACTAGAGGGATGCTGG + Intronic
1143532429 17:7513094-7513116 TGGGGGAATAAGAGGGACTCTGG - Exonic
1143762709 17:9116514-9116536 AGGGGAAATCAGAGAGATGTGGG - Intronic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1145285348 17:21501810-21501832 AGGGGGTAGCAGAGAGATGGCGG - Intergenic
1145392171 17:22463930-22463952 AGGGGGTAGCAGAGAGATGTTGG + Intergenic
1145796998 17:27661266-27661288 CGGGGGGCTCAGAGGGCTGCTGG - Intergenic
1146487519 17:33255583-33255605 AGGGGGGATCGGAGGGACGGGGG + Intronic
1146842107 17:36163455-36163477 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1146843890 17:36171796-36171818 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146854415 17:36251414-36251436 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146856196 17:36259731-36259753 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146864423 17:36328644-36328666 GGGGTGAATGAGAGGGATGGGGG + Intronic
1146870318 17:36375306-36375328 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146872103 17:36383642-36383664 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146877675 17:36426387-36426409 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146879465 17:36434727-36434749 GGGGTGAATGAGAGGGATGGGGG - Intronic
1146883390 17:36455870-36455892 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1147067281 17:37929232-37929254 GGGGTGAATGAGAGGGATGGGGG + Intronic
1147073199 17:37975930-37975952 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147074989 17:37984266-37984288 GGGGTGAATGAGAGGGATGGGGG - Intronic
1147078814 17:38008793-38008815 GGGGTGAATGAGAGGGATGGGGG + Intronic
1147084721 17:38055468-38055490 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1147086514 17:38063812-38063834 GGGGTGAATGAGAGGGATGGGGG - Intronic
1147094751 17:38132728-38132750 GGGGTGAATGAGAGGGATGGGGG + Intergenic
1147100668 17:38179434-38179456 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147102457 17:38187775-38187797 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1147791311 17:43015816-43015838 AGGGAGGGTCAGAGGGAGGCCGG - Exonic
1148227678 17:45910335-45910357 AGGGAGGTTCAGAGGGATTCAGG + Intronic
1148752498 17:49953283-49953305 AGGTGGTTTAAGAGGGATGCTGG + Intergenic
1149847032 17:60014251-60014273 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150085388 17:62270858-62270880 GGGGTGAATGAGAGGGATGGGGG - Intergenic
1152800788 17:82329822-82329844 AGGGGGAGTCAGGGAGATGAGGG - Intronic
1153096451 18:1411614-1411636 AGTGAGAATCAGAGGGAAGCAGG + Intergenic
1153272265 18:3334256-3334278 AGGGGCAGACAGAGGGATGGAGG - Intergenic
1153312120 18:3686968-3686990 AGGGGGAGTCAGAGTGTTGCAGG + Intronic
1153822806 18:8846839-8846861 AAGGGGAATCTGAGGGGAGCAGG - Intergenic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157260853 18:46174411-46174433 GGGGCGAATCGGAGGGCTGCGGG + Intronic
1157430265 18:47619136-47619158 AGGGAGAAGCTGAGGGCTGCAGG - Intergenic
1157600215 18:48889066-48889088 AGGGGGCATGGCAGGGATGCTGG - Intergenic
1157784092 18:50466686-50466708 TGGGGATATCTGAGGGATGCTGG + Intergenic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1158300547 18:56047250-56047272 AGGGAGAAAAAGAGGGATGGAGG - Intergenic
1158414840 18:57241022-57241044 AGGTGGAAGCAGAGGTATGCAGG + Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160682034 19:416369-416391 AGAGGTAACCAGAGAGATGCGGG + Intergenic
1161120050 19:2520729-2520751 TGGGGGAAGCAGAGGGGTGTGGG + Intronic
1161242061 19:3228218-3228240 AGGGGGCTGCAGAGAGATGCAGG + Intronic
1161468384 19:4444560-4444582 AGGGTGAATCAGAGAGAGACTGG - Intronic
1161814980 19:6494483-6494505 TGTGGGAATCAGAGAGAAGCTGG + Exonic
1162765679 19:12918162-12918184 AGGGTGAATGAGAGGGACCCAGG + Intronic
1163734083 19:18968042-18968064 AGGTTGACTCAGAGGAATGCAGG + Intergenic
1164574021 19:29394973-29394995 TGGGGGTGTCACAGGGATGCTGG + Intergenic
1164646138 19:29859889-29859911 ATGGGGACTCGGAGGGAAGCTGG - Intergenic
1164878947 19:31714744-31714766 AGGGTGAACCAGAGTAATGCAGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165333197 19:35152762-35152784 AGGGAGAGCGAGAGGGATGCAGG + Intronic
1165690932 19:37862582-37862604 AGAGGGAAGCAGAAGGAAGCAGG + Intergenic
1166686701 19:44800669-44800691 AGGGGGCAGCAGAGGGCAGCAGG + Intergenic
1166982367 19:46638921-46638943 AGGGAGAGTCAGAGAGACGCAGG + Intergenic
1167360861 19:49029720-49029742 AGGGGGATGCAGAGGGAGCCTGG - Intronic
1167365146 19:49050815-49050837 AGGGGGATGCAGAGGGAGCCTGG + Intergenic
1167958642 19:53088312-53088334 AGGAAGAATCAGTGGAATGCTGG + Intronic
925173685 2:1767739-1767761 AGGGTGAATAAGAAGGAAGCAGG - Intergenic
925276771 2:2655644-2655666 AGGGCGAGACCGAGGGATGCAGG + Intergenic
925879791 2:8342851-8342873 AGAGGGAAGCAGAGGGCGGCAGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927142712 2:20140862-20140884 AGGGGTCAGCAAAGGGATGCTGG + Intergenic
927812170 2:26186262-26186284 AGGGGGAACCGGGGGGCTGCTGG - Exonic
928199995 2:29241678-29241700 AGGGGGAAGCTGAGGGCTGTAGG + Intronic
929951392 2:46412234-46412256 TGTTGGAACCAGAGGGATGCTGG + Intergenic
930145372 2:47996960-47996982 AGGTGGAAGCAGTGGTATGCTGG + Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
932036850 2:68253913-68253935 AGGGGGAAGGGGAGGGATGGAGG - Intronic
932094460 2:68835320-68835342 AGAGAGAATCAGAGGGAAGCTGG + Intergenic
932469505 2:71944645-71944667 AGGGGGAGTGATAGGGATGCCGG + Intergenic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
935609536 2:105006677-105006699 GGGGTGTATTAGAGGGATGCTGG - Intergenic
936669478 2:114640209-114640231 AGAGGGATTCAGATGGGTGCTGG + Intronic
937052634 2:118905038-118905060 AGGGGGAGACAATGGGATGCTGG - Intergenic
937477709 2:122229798-122229820 TGGGGGAAACTGAGGCATGCAGG - Intergenic
938856544 2:135317963-135317985 AGGGGAAATAAGAGGGATTAGGG + Intronic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939806952 2:146785595-146785617 AGGGAGAATTAAAGGGATGCAGG - Intergenic
940005737 2:149008082-149008104 GGAGGGAATCAGAGGGGAGCGGG - Intronic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
945704627 2:213213799-213213821 AGGGGAAATCTGAGAGATGATGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
948251766 2:236535489-236535511 AGGAGGAATCCGAGGGAAGCTGG + Intergenic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
948368075 2:237471649-237471671 AGAGGGAATCAGAGGGCCGAGGG + Intergenic
1168903475 20:1385690-1385712 AGGTGAAGTCAGAGGGATGGTGG - Intronic
1169406986 20:5329977-5329999 AGGGTGAAACAGAGGCATGAAGG + Intergenic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1170606289 20:17877262-17877284 AGGGGGAAACAGAGTGATGTTGG + Intergenic
1171060823 20:21957387-21957409 AGGGGATATCACAGGGATCCAGG + Intergenic
1171336583 20:24390704-24390726 AGGTAGAATCAGAGGGAAGGTGG - Intergenic
1172884632 20:38222843-38222865 AGGGGGAGCCAGAGGGCAGCAGG - Intronic
1173456028 20:43202063-43202085 AGGGGGAAAGAAAGGGAAGCGGG - Intergenic
1173713649 20:45181942-45181964 AGGGACAAGCAGAGGGCTGCTGG - Intergenic
1173827103 20:46055127-46055149 TGGGGGAATCAGGGAGATGAGGG - Intronic
1173976526 20:47190906-47190928 ATGGGGAGTCAGGGGGATTCAGG - Intergenic
1174768463 20:53275487-53275509 AGGGGGATTTAGAGGGGTGGAGG + Intronic
1174985662 20:55448721-55448743 AGAGGGAATCTGTGGCATGCTGG - Intergenic
1175661974 20:60821243-60821265 ATGGGGAAGCTGAGGGATGCGGG + Intergenic
1176870328 21:14078804-14078826 AGTGGGAAACAGAGGGACGGAGG + Intergenic
1177896151 21:26857711-26857733 AGAAGGAGTCAGGGGGATGCTGG - Intergenic
1178824598 21:36004898-36004920 AGGGGGAGGCAGGGGGAGGCAGG + Intergenic
1178824631 21:36004965-36004987 AGGGGGAGACAGGGGGAGGCAGG + Intergenic
1179594026 21:42430366-42430388 GGAGGGAATCAGGGCGATGCTGG + Intronic
1179812976 21:43884241-43884263 AGGGGGAAGGAGGGGGAAGCGGG - Intronic
1179896105 21:44364604-44364626 GGGAGGAAGGAGAGGGATGCAGG + Intronic
1179959623 21:44760755-44760777 AGGGGATCTCAGAGGGATTCGGG - Intergenic
1179979478 21:44888760-44888782 AGAGGGACTCAGAGGGCTGCTGG - Exonic
1180798659 22:18620873-18620895 TGGGGGAGTCACAGAGATGCTGG + Intergenic
1181223055 22:21374391-21374413 TGGGGGAGTCACAGAGATGCTGG - Intergenic
1181255683 22:21561243-21561265 TGGGGGAGTCACAGAGATGCTGG + Intronic
1181766346 22:25094873-25094895 AGCGAGAATCAGAGGGAGGGAGG - Intronic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184137897 22:42560161-42560183 GGGGGGAGACAGAAGGATGCTGG - Intronic
1185004947 22:48270337-48270359 AGGGAGAGTCAGGGGGACGCTGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185091591 22:48778642-48778664 AGAGGGAAGTGGAGGGATGCAGG + Intronic
949351440 3:3127755-3127777 AGGCAGTATGAGAGGGATGCGGG - Intronic
949519105 3:4833624-4833646 AGAGGGAAACAGAAGGAAGCAGG - Intronic
950134896 3:10574198-10574220 AGCGGGCATCGGAGGGAGGCAGG - Intronic
950674984 3:14549372-14549394 AGGGGGAGCCATAGGGAGGCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952340444 3:32441250-32441272 AAGGGGAAACGGAGGCATGCAGG - Intronic
953235478 3:41102786-41102808 AGGGGGAAAGAGAGGGAACCAGG - Intergenic
954214311 3:49115952-49115974 AGGGGGAATGAGAGGGCTGGTGG + Intronic
957099114 3:75806513-75806535 AGGGGGAGACAGAGGGATTATGG - Intergenic
960523009 3:118677467-118677489 AGGGGGAGTCAGAGGCTTGCTGG - Intergenic
960596325 3:119411141-119411163 AGTGAGACTCAGGGGGATGCAGG + Intronic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
963091102 3:141484895-141484917 AGGAGGAATGAGAGGGATGGGGG + Intergenic
966365682 3:179184877-179184899 AGGGCTAATCAGTGAGATGCAGG + Intronic
967809747 3:193746907-193746929 AGGGCGAATGGGAGGGATGTGGG + Intergenic
968005435 3:195239360-195239382 AGAGGAAATGAGAGGGATGGGGG + Intronic
971715261 4:30167509-30167531 AGTGGGAGTAAGAGAGATGCGGG + Intergenic
972142088 4:35973322-35973344 AGGGGGAAAGGGAGGGAGGCAGG + Intronic
973218706 4:47700795-47700817 AGGAGGAAGCAGGGGGATGTAGG - Intronic
973780417 4:54283443-54283465 AGCTGGAGTCATAGGGATGCAGG + Intronic
975009381 4:69329888-69329910 AGAGGGAATGAGGAGGATGCTGG + Intronic
976443395 4:85103129-85103151 AGGAGGAATCTGAGGGAAGATGG - Intergenic
977048172 4:92092600-92092622 AGGGGAGACCAGAGGAATGCAGG - Intergenic
977207730 4:94182232-94182254 AGTGGGAATCAAAGGAATGGAGG + Intergenic
978619137 4:110622073-110622095 AGGGAGAACTAAAGGGATGCGGG + Intronic
978909458 4:114047456-114047478 AGAAGGAGTCAGGGGGATGCTGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
986135073 5:4969353-4969375 AGGGGGCTGCAGAGGGACGCAGG - Intergenic
986802824 5:11279423-11279445 ATGGGGCACCAGAGGGGTGCAGG - Intronic
990346342 5:54875494-54875516 AGGCGGAGTCAGAGGGTTTCAGG + Intergenic
990983358 5:61620870-61620892 AGGGGGAAACTGAGGGTTCCAGG + Intergenic
992091829 5:73324440-73324462 AGGGGGCATCCTAGGAATGCAGG - Intergenic
994953502 5:106497290-106497312 GGGGGCAATCAGAGGCATCCAGG - Intergenic
995465540 5:112446692-112446714 GGAAGGAATCAGGGGGATGCTGG - Intergenic
996383647 5:122887024-122887046 AGAGGGAAACAATGGGATGCAGG - Intronic
997375148 5:133392368-133392390 ACGGAGAGTCAGAGGGATGGGGG + Intronic
997748253 5:136318784-136318806 AGGTGGAATCAAAGGATTGCTGG - Intronic
998467911 5:142360601-142360623 AGGGGGAGACAGAGGGATTCAGG - Intergenic
998503678 5:142654879-142654901 AGGGGAGAGCAGAGGGCTGCAGG + Intronic
999111102 5:149121997-149122019 AGGGGGCATGACAGGGAGGCAGG + Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999806607 5:155087162-155087184 AGGGGAATCCAGAGGGCTGCTGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000275590 5:159732156-159732178 ATGGGGAGTGAGAGGGGTGCTGG - Intergenic
1000573239 5:162941450-162941472 AGGGGAATACAGAGGGATGGGGG - Intergenic
1002376168 5:178790565-178790587 AGGGGCTGTCAGAAGGATGCAGG - Intergenic
1002597268 5:180332246-180332268 CGGGGGGAGCAGGGGGATGCGGG + Intronic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1005089520 6:22042257-22042279 AGGGGGAAGGAGAGGGAGGGAGG - Intergenic
1005926439 6:30449442-30449464 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1005928161 6:30462014-30462036 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1006113051 6:31760347-31760369 AGGTGGAAGCACAGGGATGTGGG - Intronic
1006441782 6:34057821-34057843 AGAGTGCATCACAGGGATGCTGG + Intronic
1007346890 6:41237448-41237470 AGGGGAAATGTGAGGGATCCTGG - Exonic
1007605416 6:43114427-43114449 AGGGAGAAACAGAGGGAGACAGG - Intronic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1008423166 6:51326577-51326599 AGGGGGAACCTGGGGGATCCTGG + Intergenic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1010315775 6:74448448-74448470 AGGGGGAGACGGAGAGATGCTGG - Intergenic
1013233431 6:108176345-108176367 AGAGGGAATCTGAGGGAGGAAGG - Intronic
1014270413 6:119330019-119330041 AGGAGCAATCAGAGAGATGCAGG - Intronic
1016857091 6:148681920-148681942 GGGGGGAATCAAAGAGATGTTGG - Intergenic
1017580654 6:155861017-155861039 AGAGGGAAGGAGGGGGATGCAGG - Intergenic
1019308107 7:345943-345965 AGGGGGAGGCAGAGGGGCGCAGG + Intergenic
1019820831 7:3241613-3241635 AGCTGGAATCAGAGGCATGTAGG + Intergenic
1021194764 7:17662972-17662994 AGGGGGAAGCACAGGCATGATGG + Intergenic
1023770001 7:43548526-43548548 AGTGGAGAGCAGAGGGATGCAGG + Intronic
1025021420 7:55483405-55483427 AGGGGGAATCTGAGTCATGAAGG + Intronic
1026190190 7:68118609-68118631 AGGGGGTAGCTGAGGGTTGCAGG - Intergenic
1026494101 7:70887974-70887996 AGAGGGAATGAGAGGGAGGGTGG + Intergenic
1026676942 7:72436043-72436065 AGAGGGAATCACAGGGAAGCTGG - Intronic
1027998201 7:85454414-85454436 ATGGGGAAACAAAGTGATGCAGG - Intergenic
1029127712 7:98306190-98306212 AGGGAGTTTCAGAGGGCTGCAGG + Intronic
1030337192 7:108340137-108340159 AGAAGGAGTCAGGGGGATGCCGG - Intronic
1033652271 7:143352264-143352286 AGGGGGAGGCAGAGAGAGGCAGG - Intergenic
1033832346 7:145269736-145269758 GGGGGGATGCGGAGGGATGCGGG + Intergenic
1034451655 7:151140120-151140142 AGGGGGACCCAGAGGGAAACCGG + Intronic
1036446053 8:8822593-8822615 AGGGGGAATGAGATGGAGACAGG + Intronic
1037026425 8:14043885-14043907 AGAGAGAGTCAGAGAGATGCAGG - Intergenic
1037995520 8:23349530-23349552 AGGGGGCTTCACAGAGATGCTGG - Intronic
1039410803 8:37353540-37353562 AGGAGGAATTAGAGTGATGGAGG - Intergenic
1039744964 8:40416571-40416593 AGTGAGAATCAGAGGAATGATGG - Intergenic
1040308204 8:46223196-46223218 GGGTGGCATCAGTGGGATGCAGG + Intergenic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1043211762 8:77528383-77528405 AGGGGGAAGCCGAGTGATTCTGG + Intergenic
1045725799 8:105171692-105171714 AGGGGGAAAGAGTGGGAGGCGGG - Intronic
1045786962 8:105933069-105933091 AGGGAGAATCAGTGGGCTGTTGG - Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1048017691 8:130512214-130512236 AGGGGGACTCAGAGGAATCTGGG + Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1049212003 8:141391286-141391308 AGGGGGAAACAGAGGCAAGCTGG - Intergenic
1049227675 8:141465544-141465566 AGGGGGAGTAAGAGGGGTGCAGG + Intergenic
1050770092 9:9187585-9187607 AGAGGGAAAGAGAGGGAAGCAGG - Intronic
1052995690 9:34550682-34550704 AGGAGAAGTCAGAGGGATCCCGG + Intergenic
1053290259 9:36875107-36875129 ATGGGGAAGCAGTGGGAGGCTGG - Intronic
1053419910 9:37970815-37970837 AGGGGGAGTCACAGGGATGTAGG - Intronic
1053603420 9:39632878-39632900 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1053861050 9:42386598-42386620 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1054250117 9:62709546-62709568 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1054564228 9:66744075-66744097 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1055220464 9:73924095-73924117 AGAAGGAATCAAAGTGATGCTGG + Intergenic
1056202098 9:84286771-84286793 AGGGGGATTCAAAGTGATGGTGG - Intronic
1056276847 9:85001935-85001957 ATGGAGCATCAGAGGTATGCGGG + Intronic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057865282 9:98675294-98675316 AGGAGGAACCAGAGGAAGGCAGG + Intronic
1058038192 9:100276026-100276048 AGGGAGAATCAGAGAGTTACAGG - Intronic
1058771410 9:108236370-108236392 AGGGGGAAACAGGGAGATGGTGG + Intergenic
1059414634 9:114155440-114155462 AGGGGGCAGCAGAGGGCGGCCGG + Intergenic
1059833276 9:118122708-118122730 AGGGGGCATCAGAGGGTTTTTGG - Intergenic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1060915331 9:127385590-127385612 AGGGCAAAACGGAGGGATGCAGG + Intronic
1060979519 9:127784613-127784635 AGGGGGAATCTGGGGGCCGCTGG + Intergenic
1061348263 9:130043387-130043409 AGGGGGAGTCCTAGGGATCCGGG - Intergenic
1061942784 9:133892083-133892105 AGGGGGAAGGAGAGGGATGGGGG + Intronic
1062020912 9:134319063-134319085 AGGTGGAACCTGGGGGATGCTGG + Intronic
1062046723 9:134427769-134427791 AGGGGGAAACTGAGGCATGAGGG - Intronic
1062092227 9:134684333-134684355 GGGGGGAAACAGAGCGTTGCTGG + Intronic
1062300343 9:135863873-135863895 AGGGGGGAACACAGGCATGCGGG + Intronic
1188699771 X:33243870-33243892 ATGGGGAATCAGAAGGGTGGAGG + Intronic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189259896 X:39670833-39670855 AGAGGGAATGAGAGGGATAAGGG - Intergenic
1189711951 X:43822421-43822443 TGAGGGAATAAGAAGGATGCTGG + Intronic
1192632870 X:72790646-72790668 AGGTGGGATCAGATAGATGCAGG - Intronic
1192648839 X:72930155-72930177 AGGTGGGATCAGATAGATGCAGG + Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1195889370 X:109675413-109675435 ATAGGAAATCAGAAGGATGCAGG - Intronic
1199005717 X:142693757-142693779 GGGGAGACTCAGAGGCATGCTGG + Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1199679477 X:150215288-150215310 AGGGAGAAACAGAGGGAAGGAGG + Intergenic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic
1201057824 Y:10013324-10013346 AGAAGGAATCAGAGGACTGCTGG - Intergenic
1202374069 Y:24217855-24217877 AGGGGACATCAGTGCGATGCCGG + Intergenic
1202496712 Y:25452265-25452287 AGGGGACATCAGTGCGATGCCGG - Intergenic