ID: 904866332

View in Genome Browser
Species Human (GRCh38)
Location 1:33581915-33581937
Sequence ACTGCCATGCAAACTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904866332 Original CRISPR ACTGCCATGCAAACTGTGAA GGG Intronic
900203893 1:1423043-1423065 ATTGCCATGGCAACTGTAAATGG - Intergenic
904718881 1:32491229-32491251 TCTGTCATGCATACAGTGAAGGG + Exonic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
905505994 1:38480261-38480283 ACTGCCATGAAGACTGAGAAGGG - Intergenic
907919524 1:58899471-58899493 AGTGCTCTGTAAACTGTGAAAGG - Intergenic
907921033 1:58911806-58911828 ACTGCCATGAAAAGTCTAAAAGG + Intergenic
908438154 1:64127136-64127158 ACCGCCATGTAAAGTGTGGAAGG - Intronic
909029968 1:70528185-70528207 ACTGACATGCACAATGTCAAAGG + Intergenic
909499704 1:76320439-76320461 ACTGCCCTGCATACTATGTAGGG + Intronic
917467778 1:175298147-175298169 ACTGTTATGCAAACTGGGATTGG + Intergenic
920100225 1:203512750-203512772 GCAGCCATGCAAAATGTGAGGGG + Intergenic
923428689 1:233897934-233897956 ACTCCCATGCCAACTTTGAGAGG + Intergenic
924219598 1:241859845-241859867 TCTGCTCTGCAAACTGTTAAGGG - Intronic
1063902153 10:10745347-10745369 ATTGCCTTGAAAACTATGAAAGG - Intergenic
1065836809 10:29665834-29665856 ACTGCTATGCAAACTATGTTTGG + Intronic
1066228126 10:33404491-33404513 ACTGCCATGAATATTGTAAAGGG + Intergenic
1068075764 10:52251163-52251185 ACTGCCATCCGAAATCTGAACGG + Intronic
1068372511 10:56136102-56136124 AATGACATGCAAATTGTAAATGG - Intergenic
1068861710 10:61854605-61854627 ACTTCCATGATAACTGTTAAAGG + Intergenic
1069697404 10:70396867-70396889 ACGGTCATCCAAACAGTGAATGG - Intergenic
1070667710 10:78357140-78357162 AATGCCTTGCAGAATGTGAATGG + Intergenic
1070896676 10:79988797-79988819 AATTCCATGCAAATTGAGAAGGG + Intergenic
1071060998 10:81570810-81570832 CCTGGCATGCAAACTCAGAAGGG + Intergenic
1083751290 11:64762229-64762251 GCTGGGGTGCAAACTGTGAAAGG - Intergenic
1086178584 11:83922259-83922281 TCTGCAATGCAATCTGTGAAAGG - Intronic
1087450916 11:98323412-98323434 ACTGCTATGCTCACAGTGAAAGG - Intergenic
1089010279 11:115126674-115126696 ACTACCATGCGAACAGTGTAGGG + Intergenic
1089607594 11:119650603-119650625 GCTGCCGTAGAAACTGTGAAGGG - Intronic
1089692416 11:120195147-120195169 GCCATCATGCAAACTGTGAAAGG + Intergenic
1090102732 11:123817486-123817508 ACTGCTATACAAATTATGAATGG + Intergenic
1090652960 11:128823426-128823448 AAGGCCTTGGAAACTGTGAAGGG - Intergenic
1090900684 11:131028029-131028051 ACTGCAATGCAACCTGTGTTTGG - Intergenic
1092832050 12:12453709-12453731 ACTGAAATGCACACTGTAAAAGG - Intronic
1093967801 12:25345540-25345562 ACTGGCACTCAGACTGTGAAGGG + Intergenic
1094463606 12:30726266-30726288 AGTTCCATGAAAATTGTGAAGGG - Intronic
1095586867 12:43859370-43859392 ACTTCAGTGCAAATTGTGAAGGG + Intronic
1095809422 12:46356066-46356088 AGTCCCAGGCAAACTGGGAATGG - Intergenic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1099973212 12:89521772-89521794 ACTGCCTTGGCAATTGTGAATGG - Exonic
1100129688 12:91476052-91476074 ACTGCCATGCCCAGTGTGATAGG + Intergenic
1100575502 12:95888415-95888437 ACTCCCTTGGAAACTGGGAATGG - Intronic
1100595699 12:96070066-96070088 ACTGCCCTGCTAAGTGAGAACGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107875929 13:44790251-44790273 CCTGCCCTGCCAACTCTGAAGGG + Intergenic
1117557399 14:56900085-56900107 TCGGTAATGCAAACTGTGAATGG - Intergenic
1118425019 14:65651025-65651047 GCTGCCATGGAAACTGTGGATGG + Intronic
1119448544 14:74687900-74687922 ACTCCCATGCAGACTGTTCAGGG - Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1125536715 15:40444918-40444940 ATTGCCATGGCAACTGTGAGGGG - Intronic
1125861975 15:43008228-43008250 TCTGCCCTGCAAACTTGGAAGGG - Intronic
1127737099 15:61851954-61851976 ACTGCCATGCAGTCTAAGAAAGG + Intergenic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1133490531 16:6263658-6263680 ACTACCATGCCAACTAGGAAAGG - Intronic
1135102416 16:19617694-19617716 ACTGTCATGAAGACTGTGATAGG + Intronic
1137583347 16:49648277-49648299 ATTTCCAAGCAAACTGTGGAAGG + Intronic
1139545563 16:67648115-67648137 ACTGCCCTGGACACTGTGAGGGG + Exonic
1141521204 16:84580790-84580812 GCTCCCATGCAGCCTGTGAATGG - Intronic
1141827529 16:86491532-86491554 ACTGCCTTCCAAACTGAGCAAGG + Intergenic
1149078161 17:52621825-52621847 ACTGTCATGCAGGCTATGAAGGG + Intergenic
1149316327 17:55442365-55442387 CCTGCCATTCAAAGTCTGAATGG + Intergenic
1153074489 18:1147463-1147485 ACTGACATGTCAACTGAGAATGG + Intergenic
1154035899 18:10801556-10801578 ATTGCCATGCAAAATATAAAAGG + Intronic
1154950884 18:21208743-21208765 ACTGCAATTCAAAATGTCAAGGG + Intergenic
1156863451 18:41864476-41864498 TCTCCCTTGCAAACTGTCAATGG + Intergenic
1158422612 18:57309347-57309369 ACTGCCATGCAAAATAGGGAGGG + Intergenic
1159512100 18:69408462-69408484 ACTGTCATGTAAATTTTGAAAGG - Intronic
1162590342 19:11587268-11587290 TCTGGCATGGAAACTGTGTATGG - Intronic
1165304474 19:34995122-34995144 ACTGCTAAGCAAACAGGGAAGGG + Intronic
1165667636 19:37647380-37647402 ACTGCCATGAAAACAGTATAGGG - Intronic
1166578881 19:43874212-43874234 ACTGCCATGCAATTTTTAAAAGG + Intronic
1167733348 19:51275470-51275492 ACTTCCCTGCGTACTGTGAAGGG + Intergenic
928370020 2:30733879-30733901 ACTACCCTGCAAACTGGGAAGGG - Intronic
929331682 2:40690005-40690027 ACTGCCATGCCAAGTGTGTGAGG + Intergenic
930611895 2:53553750-53553772 CCTGCCCTGCCAACTCTGAAGGG - Intronic
932898450 2:75668910-75668932 ACTGCACTGCATACAGTGAATGG + Intronic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
934028442 2:88019508-88019530 ACTGTCATGCCACCTTTGAATGG - Intergenic
936600111 2:113887611-113887633 ACTTCCATGACAACTGTGCAAGG + Intergenic
940436022 2:153656027-153656049 TTTGTTATGCAAACTGTGAATGG + Intergenic
941297846 2:163762434-163762456 AATTCCAGGCAAAATGTGAAGGG + Intergenic
941659505 2:168181283-168181305 GTTGCCCGGCAAACTGTGAAGGG - Intronic
942332955 2:174847928-174847950 ACTGCCAGGTAAATTATGAAAGG + Intronic
942649589 2:178153017-178153039 GCTGCCATGTAAACTGTAAAGGG - Intergenic
943233109 2:185282912-185282934 ACTGCATTGCAATCTCTGAAGGG + Intergenic
944682503 2:202090011-202090033 TCTGCCATGGACACTGGGAAGGG + Intronic
945257261 2:207813083-207813105 ACTGGCAAGCAAACGTTGAAAGG - Intergenic
946983506 2:225246098-225246120 GCTGCCATGCTAACTCTGGAGGG - Intergenic
948548562 2:238751444-238751466 AATGGCATGTAAACTGGGAAGGG + Intergenic
1169626795 20:7580192-7580214 ACTGTTATGCAAACTGTTATAGG - Intergenic
1172196900 20:33098018-33098040 AATGCCAAGCAAATTGTGCAAGG - Intronic
1175570982 20:60021547-60021569 ATTGCCATACAAATTTTGAAAGG + Intronic
1176266383 20:64211625-64211647 AGTGCCATCCAAGCTGGGAAGGG + Intronic
1180025845 21:45161611-45161633 GATGCCATGCACACTGTGGATGG + Intronic
1180221649 21:46362932-46362954 ACTGCAAGGCACACTGTAAAGGG - Intronic
1181902271 22:26166357-26166379 ACTGCCATGGAAACAGTAAAAGG + Intergenic
1182005736 22:26957980-26958002 ACTGCATTGCAGACTGTAAATGG - Intergenic
949337373 3:2990579-2990601 ACTGGGATGCAAACTCTGATGGG - Intronic
950845449 3:16011308-16011330 ACTGCCATGAAAACTGTGGCAGG - Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
952615507 3:35267301-35267323 ACTGCACTGGAAACTCTGAATGG - Intergenic
954416325 3:50395231-50395253 CATGCCAGGCACACTGTGAATGG - Intronic
954729888 3:52651217-52651239 ACTGCCAGGGATACAGTGAAGGG + Intronic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961921361 3:130429793-130429815 ACTGACTTGTAAACTGTGATGGG - Intronic
962522655 3:136211564-136211586 ACTGCCATACTAACTGTGCATGG - Intergenic
969065687 4:4478690-4478712 ACTGCCATGCATCATGTGGAGGG + Intronic
971239892 4:24878917-24878939 AGGGCCATGAAAGCTGTGAAGGG + Intronic
971856590 4:32052551-32052573 ACTGACATGGCAACTGTCAAAGG + Intergenic
972815693 4:42642819-42642841 ACTGCCATGCAAGGTGTGATGGG + Intronic
974976604 4:68901534-68901556 ATGGCCATGCAAAAAGTGAATGG - Intergenic
975001748 4:69232715-69232737 TTGGCCATGAAAACTGTGAATGG - Intergenic
975003696 4:69259379-69259401 TTGGCCATGAAAACTGTGAATGG + Intergenic
978171412 4:105675349-105675371 ACTGCCATGCGCTCTGTAAAAGG + Intronic
981219874 4:142219433-142219455 ACTTTAAAGCAAACTGTGAAGGG - Intronic
983881199 4:172935165-172935187 GCTGCCCTGCAGACTGTGAGTGG + Intronic
985368879 4:189263855-189263877 ACTTCCATGGAAACTATGGAGGG + Intergenic
986048666 5:4066083-4066105 GTTTCCATGCAAACTGTGAGTGG + Intergenic
986213081 5:5692276-5692298 ACAGCCATGAAAACTCAGAAAGG - Intergenic
987994321 5:25255243-25255265 ATTGCTTTGCAAACAGTGAATGG - Intergenic
988828713 5:34967327-34967349 AATGCCATGCACACTGTCCAGGG - Intergenic
991562117 5:67964895-67964917 ACTGCAATGCAGTTTGTGAAAGG - Intergenic
993491168 5:88551854-88551876 ACTGACAGGCAAACTGTGCTGGG - Intergenic
993587564 5:89750025-89750047 ACTTTAATGCAAACTTTGAAAGG - Intergenic
995446794 5:112253873-112253895 ATTACCATGTAAAATGTGAAAGG + Intronic
996035360 5:118752703-118752725 ACTGCTATGTGAACTGTGGAAGG - Intergenic
1000141282 5:158405590-158405612 GCTGCCATGGGATCTGTGAATGG - Intergenic
1001595635 5:172896967-172896989 ACAGAAATGCAAACTGTTAAGGG - Intronic
1002483093 5:179516392-179516414 ACTGCCTTGCAAACTGCGTGAGG - Intergenic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1006908805 6:37550564-37550586 ACAGCCATGCAGTGTGTGAAAGG + Intergenic
1007207213 6:40162720-40162742 ACTGCCTTGAAAACTGGGCAAGG - Intergenic
1008453216 6:51677250-51677272 ACTGTCTAACAAACTGTGAAAGG - Intronic
1026121246 7:67539739-67539761 ACTGGCTTTCAAACTGTGATTGG - Intergenic
1028848956 7:95514828-95514850 AATTCCATCCAAAGTGTGAAGGG + Intronic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1032519066 7:132528958-132528980 GCTGCCATGAAGACTATGAAGGG + Intronic
1034377396 7:150658128-150658150 AGTACCAGGCATACTGTGAAAGG + Intergenic
1035308985 7:157952950-157952972 AAAGCCATGCACACAGTGAAGGG + Intronic
1036543391 8:9741449-9741471 ACTGCTATAAAGACTGTGAAAGG - Intronic
1038412825 8:27371360-27371382 TCTTCCATGCACACTGGGAATGG + Intronic
1039592184 8:38757980-38758002 ACTGTAATGAAAGCTGTGAAGGG + Intronic
1040086001 8:43342518-43342540 ACTGCCCTTCACACTGAGAAAGG - Intergenic
1040406606 8:47110200-47110222 ACTGCCCTTCATACTGAGAAAGG + Intergenic
1042906642 8:73778559-73778581 ACTGCCATGTAAATTTAGAAAGG - Intronic
1045757787 8:105566098-105566120 ACTGCCCTCCAAAATATGAATGG - Intronic
1046663947 8:116978880-116978902 ACTGTCATCCTACCTGTGAAGGG + Intronic
1049066722 8:140322046-140322068 ACTGCCTTGCACTCAGTGAAGGG - Intronic
1050286668 9:4109976-4109998 ACAGCTATGCAAACTTTTAATGG - Intronic
1053600063 9:39601796-39601818 ACTGTCATGCCACCTTTGAATGG + Intergenic
1053857714 9:42355652-42355674 ACTGTCATGCCACCTTTGAATGG + Intergenic
1054253462 9:62740588-62740610 ACTGTCATGCCACCTTTGAATGG - Intergenic
1054567580 9:66775087-66775109 ACTGTCATGCCACCTTTGAATGG - Intergenic
1055435567 9:76288713-76288735 AACCCCATGCAGACTGTGAAAGG - Intronic
1055697847 9:78906933-78906955 ACATCTATGAAAACTGTGAATGG - Intergenic
1059409015 9:114120408-114120430 AATGCCTTACAAACTGTAAAGGG - Intergenic
1060045015 9:120333011-120333033 GCTGCCATGCAAGCTTTGGAAGG + Intergenic
1062218956 9:135404100-135404122 ACTGCCTTGCTAACTGATAAAGG - Intergenic
1187126776 X:16461830-16461852 ACTGACTTGTAAACTTTGAAAGG + Intergenic
1188189376 X:27156210-27156232 ACTGCCATGCTAATTTTGATGGG + Intergenic
1191950707 X:66589008-66589030 ACTGCCATGCCAGTTGTGCATGG - Intergenic
1195173928 X:102296868-102296890 ATTTCCATGCAAACTCTGGAAGG + Intergenic
1195184937 X:102390225-102390247 ATTTCCATGCAAACTCTGGAAGG - Intronic
1195856349 X:109336770-109336792 AAGGCCAGGCCAACTGTGAAGGG - Intergenic
1199132813 X:144213025-144213047 ACTGCTAAGCAAAGTGTGAAAGG - Intergenic
1200967632 Y:9112903-9112925 AATGCAATGAAAACGGTGAAAGG - Intergenic
1201700335 Y:16874309-16874331 AATGTCATTCAAAGTGTGAAAGG - Intergenic
1202131285 Y:21613491-21613513 AGTGCCATAAAAACTGAGAAAGG - Intergenic
1202143572 Y:21754553-21754575 AATGCAATGAAAACGGTGAAAGG - Intergenic