ID: 904868642

View in Genome Browser
Species Human (GRCh38)
Location 1:33602462-33602484
Sequence CAGTCCTGGGAGCTGGAGTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904868637_904868642 4 Left 904868637 1:33602435-33602457 CCAATGGGCACGGTGATCAGCCA 0: 1
1: 0
2: 0
3: 4
4: 69
Right 904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG 0: 1
1: 0
2: 2
3: 40
4: 349
904868636_904868642 10 Left 904868636 1:33602429-33602451 CCATGGCCAATGGGCACGGTGAT 0: 1
1: 0
2: 0
3: 6
4: 62
Right 904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG 0: 1
1: 0
2: 2
3: 40
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904868642 Original CRISPR CAGTCCTGGGAGCTGGAGTA CGG Exonic
900683272 1:3930867-3930889 CAGCCCCGGGAGCTGGAGAGGGG + Intergenic
901206119 1:7496834-7496856 CAGCCCTGGGAGGTGGTGTTGGG - Intronic
901290214 1:8118213-8118235 CAGTTCTAGGACCTGGTGTAGGG + Intergenic
902611988 1:17602953-17602975 CAGGCCTGGGAGCTGGTGTGGGG + Intronic
903006826 1:20304082-20304104 CAGTCCAGGGAGCTGGAACAAGG + Intronic
903627563 1:24742543-24742565 CAGTCCTGGGAGTGGGTGAAAGG - Intergenic
904153946 1:28466623-28466645 GAGTCCTGGGTGCTGGGGAAGGG - Exonic
904259443 1:29280028-29280050 CAAAGCTGGGAGCTGGAGAAGGG - Exonic
904300245 1:29549483-29549505 CAGGCCTGGGAGCAGCAGTGGGG - Intergenic
904457990 1:30658632-30658654 CAGGCCTGGGAGCAGCAGTGGGG + Intergenic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG + Exonic
905102752 1:35539918-35539940 CAGACCTGGGAGATGGAGTGGGG - Intronic
905674971 1:39818617-39818639 CACTGCTGGGGGCTGGAGCAGGG + Intergenic
905871009 1:41404628-41404650 CTGTGCTGGGAGCTGGGGGAGGG + Intergenic
906033932 1:42739425-42739447 CAGGCCTGGGAGCAGGACTAGGG + Intronic
906819835 1:48918052-48918074 CAGGCCTGGCTGCTGGAGAAAGG - Intronic
907242180 1:53086925-53086947 CTGTCCTGGTGGCTGCAGTAAGG - Intergenic
907332930 1:53683134-53683156 CAGTCCTGGCATATGGAGTCTGG + Intronic
907337694 1:53711014-53711036 CAGTCCTGGGGTGTGGGGTACGG - Intronic
907441476 1:54481196-54481218 AAGGCCTGGGAACTGGAGGATGG + Intergenic
909024094 1:70463233-70463255 CAGTGCTGGGGTCTGGAGGATGG - Intergenic
909066275 1:70939387-70939409 CAGTTCTGGGGTCTGGAGGAAGG + Intronic
910129515 1:83886834-83886856 TAGGCCTGAGAGCTGGAGAATGG - Intronic
910247063 1:85150061-85150083 CCTCCCTGGGAGGTGGAGTAAGG - Intergenic
911302577 1:96193011-96193033 CAGTTCTGGGTTCTGGAGGATGG - Intergenic
914849510 1:151303639-151303661 CACTTCGGGGAGCTGGAGAAAGG + Exonic
915321261 1:155057619-155057641 CAGTCCTGTGGGCAGGAGCACGG - Exonic
916934866 1:169617237-169617259 CAGTAGTAGGAGCTGTAGTAGGG + Exonic
916975365 1:170071747-170071769 CAGTGTTGGGAGCTGGAGCCTGG - Intronic
917315074 1:173715512-173715534 CAGTCCAGGGAGCTTGAACAGGG - Intronic
919753815 1:201054274-201054296 GAGCCCTGGGAGATGGAGTGCGG - Intronic
920146983 1:203870257-203870279 CAGTATTGGGAGGTGGAGAAGGG + Exonic
923330353 1:232918016-232918038 CAGTCCTGAGAGCTGCTGAAGGG + Intergenic
923730314 1:236543717-236543739 CGGTCCTGTGAGCTGGAAGAAGG + Intronic
923956972 1:239033111-239033133 CCCTCCTGGGAGATGGAGCAAGG - Intergenic
1063555598 10:7076074-7076096 CAGCACTGGGAGATGGTGTACGG - Intergenic
1064353284 10:14596251-14596273 CAGTTCAGGGGGCTGGAGTCTGG - Intronic
1066008096 10:31166461-31166483 CATTGCAGGGAGCTGGAGTGCGG - Intergenic
1066302264 10:34107534-34107556 CACCCCTGTGAGGTGGAGTAAGG - Intergenic
1066307424 10:34159582-34159604 AAGTCCTGAAAGCTGGAATATGG + Intronic
1067053292 10:43037500-43037522 CTGGCCTGGGTGCTGGAGTGGGG + Intergenic
1067497288 10:46772950-46772972 CAGTCCTGAGTCCTGGAGCAGGG - Intergenic
1067575156 10:47404167-47404189 CAGGCTGGGGAGCTGGAGGAAGG + Intergenic
1067597364 10:47567465-47567487 CAGTCCTGAGTCCTGGAGCAGGG + Intergenic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1069030178 10:63587966-63587988 CAGTTCTGGGTGCTGGTGCAAGG - Intronic
1069964714 10:72105007-72105029 CAGACATGGGAGCTGGAGAAGGG - Intronic
1070140711 10:73735075-73735097 CAGTCCTGAGTCCTGGAGCAAGG + Intergenic
1070154673 10:73826045-73826067 CTGTCCTGGGGGCTGGATTCTGG - Intronic
1070250099 10:74766046-74766068 GAATCCTGGAAGCTGGAGTCTGG - Intergenic
1070392111 10:75980330-75980352 CAGGGCTGGGTGCTGGAGAAGGG - Intronic
1070654219 10:78260190-78260212 AAGTCCTGGGAGCTGTATTGTGG - Intergenic
1070895669 10:79981735-79981757 CAGCCCTGGGAGCCGGAGGATGG + Intronic
1070968887 10:80547554-80547576 CAGTGCTGGGAGCGGGAGGGAGG + Intronic
1072647361 10:97267442-97267464 CAGTTCTGGGATCTGGAAGATGG + Intronic
1072805932 10:98424072-98424094 CTGTCCTGGGTGCAGGAGCAGGG - Intronic
1073037901 10:100576965-100576987 CTGTCCAGGGAGCTGAAGAAGGG - Intergenic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1074977860 10:118595709-118595731 CATACATGGGAGCTGGAGTGGGG - Intergenic
1075399542 10:122151118-122151140 CACTGCTGGGAGTTGGAGTGGGG - Intronic
1076549148 10:131266985-131267007 CAGTCCTCTGGACTGGAGTAGGG - Intronic
1076770416 10:132659793-132659815 CTGCCCTGGGAGGTGGAGCATGG + Intronic
1077114876 11:879606-879628 CAGTCCTGGGGGCTGGAGGTGGG - Intronic
1077249553 11:1555030-1555052 CAGTCCTGAGTCCTGGAGCAGGG - Exonic
1077271963 11:1685596-1685618 CACTCCTGGGAGCAGGAGGAGGG - Intergenic
1077398677 11:2341181-2341203 CAGTCGTAGGAGGTGGAGGAGGG - Intergenic
1079104733 11:17563333-17563355 CAGTGCTGGGGGCTGGAGCAAGG - Intronic
1081732202 11:45379522-45379544 TGGTTCTGAGAGCTGGAGTAAGG - Intergenic
1081874738 11:46400906-46400928 CTGCCCTGGGAGCTGGAGCCGGG - Intronic
1083011150 11:59400903-59400925 CAGTAGTGGGATCTGAAGTAGGG + Intergenic
1083292155 11:61696308-61696330 GAGTCCTGGGAGCGGGAGAGTGG + Intronic
1083586421 11:63863087-63863109 CAGTCCTGGGAGCTGAACTCTGG + Intronic
1083651960 11:64209129-64209151 CAGCCCTGAGAGGTGGTGTAGGG + Intronic
1083941744 11:65899848-65899870 AATTCCTGGGATCTGGAGTCTGG - Intronic
1084184376 11:67464032-67464054 CAGGCCTGGGACCTGGAGGCTGG - Exonic
1085023268 11:73222138-73222160 GAGGCCTGGGTGCTGGAGTGAGG + Intronic
1085202147 11:74708307-74708329 CAGGCCTGGCAGCAGGAGTCTGG + Exonic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1086695301 11:89837608-89837630 AAATCCTGGGAGCTGATGTAAGG + Intergenic
1086710851 11:90006877-90006899 AAATCCTGGGAGCTGATGTAAGG - Intergenic
1088435204 11:109804715-109804737 CAATGCTGGGATCTGGAGGATGG + Intergenic
1088561575 11:111120856-111120878 CTGTCCTTGGAGCTGGAGGGTGG - Intergenic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1089399634 11:118156963-118156985 CAGTGCTCTGAGCTGGAGGAAGG - Intergenic
1089563054 11:119355560-119355582 CTGCCCTGGGAGCTGGAGCCTGG - Exonic
1089740463 11:120578691-120578713 CGGCCTTGGGAGCTGGAGTCAGG + Intronic
1090293511 11:125566982-125567004 CAGTGAGGGGAGCTGGAGAAGGG + Intergenic
1091025951 11:132141546-132141568 CATGCATGGGAGCTCGAGTATGG - Intronic
1091195911 11:133730625-133730647 CAGCCCTGGAGGCTGTAGTAAGG - Intergenic
1091338917 11:134795282-134795304 CTGTCCTGGGAGCTGCAGAGGGG - Intergenic
1095722705 12:45417885-45417907 CAGTGCTGGGAAGTGGAGTTCGG - Intronic
1096393491 12:51247956-51247978 CTGACCTGGGAGCTGAAGCAGGG + Intronic
1097188918 12:57210296-57210318 CAGGCCGGGGAGCTGCAGGAAGG - Exonic
1098156621 12:67606155-67606177 CAGTGCTGGGAGCAGCAGTGAGG - Intergenic
1102233386 12:111278931-111278953 CCTTGCTGGGAGCTGGGGTAGGG - Intronic
1102328571 12:112010886-112010908 CAGTCCTGCAGACTGGAGTAGGG - Intronic
1102642584 12:114380031-114380053 AAGTCTAGGGGGCTGGAGTAGGG - Intronic
1102699105 12:114823769-114823791 CTGGCCTGGGCCCTGGAGTAGGG - Intergenic
1103933593 12:124463566-124463588 CAGTTCTGAGTGCTGGAGTCTGG - Intronic
1104928421 12:132325715-132325737 CAGACCTGGGACCTGGGCTAGGG + Intronic
1104945976 12:132415047-132415069 CCGTCCTGGTGGCTGGAGGACGG + Intergenic
1104968004 12:132518064-132518086 CAGTCCTGTGTGCCGGAGGAGGG - Intronic
1106434340 13:29710538-29710560 CTGTCCTGGGAGCTGGATGTTGG + Intergenic
1106576318 13:30979026-30979048 CAGTCCCGTGAACTGGAGTAGGG - Intergenic
1107875832 13:44789922-44789944 CAGTCCTGCGGGCTGGAGTGGGG - Intergenic
1107899459 13:44997546-44997568 GAGTTTTTGGAGCTGGAGTAGGG - Intronic
1108044066 13:46366265-46366287 CTGTCCTGGGATCTGGACTGAGG + Intronic
1108083972 13:46765380-46765402 CAGCCCTGGGAGTTAGTGTAGGG + Intergenic
1108690844 13:52857762-52857784 CAGGGCTGGGAGCTGGAAAAAGG + Intergenic
1109525249 13:63566575-63566597 CAGTCCTGTGGACTGGAGTGGGG + Intergenic
1110115981 13:71817289-71817311 CAGTCCTGGGAGCTGGCATATGG - Intronic
1112051826 13:95650340-95650362 CATTCCTGGGAGGTGGAGAAAGG - Intergenic
1112461237 13:99605647-99605669 CAGGCGTGGGAGCTGGGGGAGGG + Intergenic
1113654642 13:112060281-112060303 CACTCCGGGGAGCAGGAGTGGGG + Intergenic
1114555592 14:23560407-23560429 CTGGGATGGGAGCTGGAGTAGGG + Exonic
1114986072 14:28230545-28230567 CAATTCTGGGATCTGGAGGATGG + Intergenic
1115051828 14:29072414-29072436 CAATTCTGGGGGCTGGAGGATGG + Intergenic
1117421773 14:55553838-55553860 CAGTACGGGGAGCTGGAGTTGGG + Intergenic
1118524577 14:66624529-66624551 CTGTCCTTGGAGCTGGAGGGTGG - Intronic
1119509300 14:75198536-75198558 CACTCCTGGAAGCTTGAGAAGGG - Intergenic
1120971878 14:90214559-90214581 CAGTTCTGGGACCTGGGGGATGG + Intergenic
1121279270 14:92687701-92687723 CAGTTCTGGGAGATGAATTAAGG - Intronic
1121515193 14:94545117-94545139 ATGTCCTGGGAACTGGAGTCAGG - Intergenic
1122801345 14:104231183-104231205 CAGGACTGGGAGCTGGAGCCTGG + Intergenic
1122974018 14:105163743-105163765 CAGTCCTGGGACCTGGGGACAGG + Intronic
1124218169 15:27826522-27826544 CAGTGCAGGGAGCTGGGGAAAGG - Intronic
1128066410 15:64767501-64767523 CAATCCTGCGAGCTGGAGGCAGG - Intronic
1128497610 15:68207264-68207286 CATTCCTGGGGGCTGGAGGGTGG - Exonic
1128711350 15:69874608-69874630 CAGTCCTGGGAGCTGGCCATTGG - Intergenic
1128942541 15:71800398-71800420 CAGTCCTGGGAGCAAGTGTCAGG - Intronic
1129330404 15:74824165-74824187 CAGCCATGGGAGCTGGGGTGGGG + Intronic
1129467373 15:75731617-75731639 GAGTGCTGGGAGCAGGAGTGGGG - Intergenic
1129719835 15:77871994-77872016 GAGTGCTGGGAGCAGGAGTGGGG + Intergenic
1130048097 15:80461587-80461609 CAGTCCTGGGAGCAGAGGCATGG + Intronic
1130146114 15:81274962-81274984 CAGTCCTTGGAGCTGGAGCCTGG - Intronic
1131264121 15:90905738-90905760 GACTCCTGGGAGCTGGAGTGTGG + Intronic
1131957065 15:97748095-97748117 CAGTCCTGGGAGGAGGGGGAGGG - Intergenic
1132645051 16:995118-995140 CAGTCCTGGGAGAAGCAGGATGG + Intergenic
1135424197 16:22324257-22324279 CAGGCCTGGGAGCTGGAGCCTGG - Intronic
1136112135 16:28070335-28070357 CTGTCCTGGGTGTTGGAGTCAGG - Intergenic
1137716352 16:50600764-50600786 CAGGCCTGAGGGCTGGAGGAAGG + Intronic
1138157797 16:54722068-54722090 CAGAGCTGGGATCTGGAGCAAGG + Intergenic
1138263501 16:55643179-55643201 CAGTCCGGGGAGCTGGAGAAAGG - Intergenic
1138997676 16:62474504-62474526 CAGTTCTGGGATCTGGAGGATGG - Intergenic
1140809722 16:78565844-78565866 CAGTCCTGAGAGATGGAGCTGGG - Intronic
1142259965 16:89038038-89038060 CAGTCCTGGGGGCAGGGGCAGGG + Intergenic
1142326629 16:89419794-89419816 CACTCCTGGAAGATGGAGTGAGG + Intronic
1143601567 17:7949411-7949433 CAGTCTTGGGGGCTGTAGCAAGG - Exonic
1145388983 17:22440530-22440552 CTGTCCTGGGAGCAGGATTCTGG + Intergenic
1145816188 17:27796729-27796751 CAGTGTGGGGAGCTGGAGTCAGG + Intronic
1145941362 17:28744858-28744880 CTCTCCCGGGGGCTGGAGTAAGG + Intronic
1146400761 17:32498292-32498314 CAGTCCTGGGAGGGGCAGTGTGG - Intronic
1147164549 17:38586395-38586417 CAGGGCTGGGAGGTGGAGGAGGG - Intronic
1147316712 17:39624423-39624445 GACTCCTGAGAGCTGGAGGAGGG - Intergenic
1147771631 17:42872224-42872246 CAGTCCAGGGATTTGGAGGAGGG - Intergenic
1147951665 17:44111100-44111122 GGTTCCTGGGAGCTGGGGTATGG + Intronic
1148194787 17:45705527-45705549 CAGTCTTGGGACCTGCAGGAAGG + Intergenic
1148775230 17:50091500-50091522 CAGGCCTGGGGAATGGAGTAAGG + Intergenic
1150285143 17:63950061-63950083 CAGTGTTGGGAGCGGGAGTGGGG + Intronic
1150350138 17:64437989-64438011 CCGTTCTGGGATCTGGAGGATGG + Intergenic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1151321573 17:73355742-73355764 CTGTGCTGGGTGCTGGACTAAGG - Intronic
1151392314 17:73795629-73795651 CAGTCCTGGGAGCTGCTCCAGGG - Intergenic
1152101024 17:78301811-78301833 CACTTCTGGGGGCTGGAGTCTGG + Intergenic
1153440875 18:5117770-5117792 CTGTTCTGGGATCTGGAGGATGG - Intergenic
1154316610 18:13309240-13309262 CTTTGCTGGGAGCTGGGGTACGG + Intronic
1154492428 18:14932192-14932214 CAGACCTGGGAGGTGGGGTGGGG + Intergenic
1155242155 18:23873761-23873783 CAGCCCTGGAAACTGGATTAGGG + Intronic
1156242576 18:35267904-35267926 CAGTCCTAGGAGCTGCGGAAGGG + Intronic
1158503406 18:58024313-58024335 CTGTCCTGGGAGATGGACTTTGG - Intergenic
1158772659 18:60539574-60539596 AAGGGCTGGGAGTTGGAGTAGGG + Intergenic
1158802083 18:60923897-60923919 CAGTTCTGCCAGATGGAGTAGGG + Intergenic
1158940283 18:62401306-62401328 AAATCCTGGGAGCTGGGGAAAGG - Intergenic
1160430611 18:78809504-78809526 GAGTCCTGGGAGATTGGGTAAGG - Intergenic
1161909771 19:7184457-7184479 CAGTCCTGGAAGTGGTAGTACGG + Exonic
1162571885 19:11479189-11479211 CAGGTCTGGGAACTGGAGTGTGG - Intronic
1163193428 19:15696714-15696736 CTGAGCTGGGAGCTGGAGTCAGG + Intronic
1163200075 19:15760592-15760614 CTGAGCTGGGAGCTGGAGTCTGG - Intergenic
1163455810 19:17405087-17405109 CAGTCCAGGGCACTGGTGTAGGG - Intronic
1165725110 19:38107265-38107287 CAGTCTTGGGGCCTGGGGTAGGG + Intronic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1167163207 19:47780775-47780797 CATTCCTGGGAGCTGGGGAGGGG + Intronic
1167908663 19:52683587-52683609 AAGACCTGGGAGCTGGAGTGAGG + Intronic
1167939809 19:52937491-52937513 AAGACCCAGGAGCTGGAGTAAGG + Intronic
1167944722 19:52978822-52978844 GAGACCCGGGAGCTGGAGTGAGG + Intergenic
1167960173 19:53098806-53098828 AAGACCCGGGAGCTGGAGTAAGG + Intronic
1167963960 19:53128614-53128636 AAGACCCGGGAGCTGGAGTAAGG + Intronic
1167988491 19:53338345-53338367 GAGACCCGGGAGCTGGAGTGAGG - Intronic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926919810 2:17929336-17929358 CAGTCCTGGCAGCAGGTGAAAGG + Intronic
927208162 2:20623044-20623066 CAGTCCTGTGTCCTGGAGCATGG + Intronic
927499070 2:23570318-23570340 GAGTCCCGGGAGCTGGGGAATGG + Intronic
927576836 2:24207654-24207676 CAGTGCAGGGAGCTGGGGCAGGG + Intronic
927849136 2:26487918-26487940 CTGGCCTGGGAGCTGGAGACAGG + Intronic
928297472 2:30096937-30096959 AAGTCCGGGGAGCTGGTGTAAGG - Intergenic
930419706 2:51135233-51135255 CCGTTCTGGGATCTGGAGGATGG - Intergenic
932577652 2:72971631-72971653 CGGTACGGGGAGCTGGAGGAAGG - Exonic
934718686 2:96558115-96558137 CAGGCCAGGGAGCTGGAGTGGGG - Intergenic
934915693 2:98299385-98299407 CAGGCCTTGGAGCTGGAATTAGG - Intronic
935058562 2:99588810-99588832 CAGTACTGGGTGCTGGAGATGGG - Intronic
935113098 2:100109870-100109892 AAGTTGTGGGAGGTGGAGTATGG - Intronic
935713690 2:105920854-105920876 AAGTCCTGGGAGATAGAGGAAGG + Intergenic
935754188 2:106264453-106264475 CAGCCCTGGGAGCTGCAGACAGG - Intergenic
936114243 2:109689267-109689289 CAGCCCTGGGAGCTGCAGACAGG + Intergenic
937013525 2:118582847-118582869 CAGGCCTGGGAGATGCAGTGAGG + Intergenic
937149143 2:119673932-119673954 CAGTCTTGTAAGCTGGAGTGAGG - Intergenic
937360199 2:121224300-121224322 CAGGGCTGGGAGCTGGAGACAGG + Exonic
938082632 2:128378385-128378407 CACTCCTGGGAGATGGAGACTGG - Intergenic
938091147 2:128435694-128435716 AAGTCCAGGGAGCAGGAGTGCGG + Intergenic
938614345 2:132981877-132981899 AAATACTGGTAGCTGGAGTATGG + Intronic
938766491 2:134463431-134463453 CAGACCTGGGATTTGGGGTAGGG - Intronic
939614855 2:144350666-144350688 CAGTCCTGGGAGAGGAAGAAGGG + Intergenic
940635342 2:156292439-156292461 CAGTCCTCGGACCTGGGGTTGGG - Intergenic
940760951 2:157738700-157738722 CAGTCCTGGAAGCTAGAGGTAGG + Intronic
943022529 2:182592487-182592509 CAGTCATGGAAGCTGGTGTTGGG - Intergenic
943091272 2:183377646-183377668 CATTCCTGGGGCCTGGAGTCTGG - Intergenic
946032201 2:216714230-216714252 CAGTCCTGGGAGAGGAAGTTTGG - Intergenic
946198107 2:218050514-218050536 CAGTTCTGTGAGCTGGAGGGAGG - Intronic
946225485 2:218262048-218262070 CCTTCCTGGGAGCTGGAGGGAGG - Exonic
947316691 2:228866484-228866506 CAGTCCTGCCAGCTGGAGGGGGG + Intronic
947837203 2:233184397-233184419 CAGTCCCGGGACCTGGAACAGGG - Exonic
948646150 2:239406400-239406422 CAGACCTGGGGGCTGGAGATGGG + Intergenic
948846004 2:240683097-240683119 CAGCCCTGGGCGCTGGAGACTGG + Intergenic
948847852 2:240691632-240691654 CAGCCCTGGGCGCTGGAGACTGG - Intergenic
948987322 2:241533379-241533401 CAGGCCTGGGAGCTGGGTGAGGG + Intergenic
1169074622 20:2752982-2753004 GAGTCCTGGGAGCTGGGGGGCGG - Intronic
1172184718 20:33024170-33024192 CAGCTCTGGGAGCCGGAGAATGG - Intergenic
1173524463 20:43721432-43721454 CAGTCCTGAGGGCCGGAGTGGGG - Intergenic
1173646044 20:44633784-44633806 GAATCCTGGGAACTGGAGGAAGG + Intronic
1174559242 20:51418081-51418103 CTGTCCTGGGTGCTGTACTAGGG + Intronic
1174734367 20:52951227-52951249 CAGTCCTGAGAGCTGGGGAAAGG + Intergenic
1175013567 20:55764569-55764591 CCATTCTGGGAGCTGGAGGATGG + Intergenic
1175207758 20:57324799-57324821 CAGTCATGGAAGCTGGTGTTGGG + Intergenic
1175962040 20:62642268-62642290 CGGTCCTTGGAGCTGGAGCGGGG + Exonic
1176157343 20:63628146-63628168 GAGCCCTGGGGGCTGGAGGAGGG - Intergenic
1177918698 21:27123895-27123917 CAATTCTGGGATCTGGAGGATGG + Intergenic
1178785416 21:35648947-35648969 GAGTACTGGCAGCTGGAGTTGGG - Intronic
1179015684 21:37592829-37592851 CTGCCCTGGGTGCTGGAGGAGGG - Intergenic
1180145080 21:45914282-45914304 CAGTTCTGGGAACTGGATTTAGG - Intronic
1180206001 21:46261027-46261049 GTGTCAGGGGAGCTGGAGTAGGG - Intronic
1181043391 22:20203473-20203495 CAGTGCTGGGAGGTGGAGGCTGG + Intergenic
1181163883 22:20973453-20973475 CAATCCTGAGGGCTGGGGTAGGG - Exonic
1181440627 22:22933630-22933652 CAGGCCTAGGAGCTGGATCAAGG + Intergenic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1183000604 22:34855596-34855618 CAGTCCTCTGAGCTGGACCAGGG - Intergenic
1183212889 22:36461848-36461870 CACTCCTGGGAGCAGCAGTGTGG + Intergenic
1183540431 22:38426619-38426641 CAGGCCTGGGTGCTGGAGTCAGG + Exonic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1184177598 22:42797847-42797869 CAGTCCTGGGATCAGGAGGCAGG + Intronic
1184391939 22:44207726-44207748 CAGCCCTGGGAGCTGGTGTCTGG + Exonic
1185320473 22:50198278-50198300 CAGGCATGGGGGCTGGGGTATGG + Intronic
950452434 3:13072917-13072939 CTGAGCTGGGAGCTGGAGTGAGG - Intronic
951733676 3:25838336-25838358 CAGTCCTGTTACCAGGAGTATGG - Intergenic
952931391 3:38363796-38363818 CAGTGCTGGGAGTGGGAGTCAGG + Intronic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
953574659 3:44103437-44103459 CAGACCTGGGGGCAGGAGAAGGG - Intergenic
954378664 3:50207974-50207996 AAGTCCTGGGTGCTGGACCAGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956133767 3:66078987-66079009 GAGTCCTGGGAGCTGGGGTGCGG + Intergenic
956695987 3:71919892-71919914 CACTACTGGGAACTGGAGAAAGG - Intergenic
960536059 3:118815702-118815724 TAATCCTGGGAGCTGGGGTGTGG - Intergenic
960986491 3:123284502-123284524 CAGCCCTGCGGGCTGGAGCATGG + Exonic
961473771 3:127134609-127134631 CCTTCCTGGGAGGTGGAGTGAGG + Intergenic
961615286 3:128174555-128174577 CAGGCCTGGGCTCTGGAGTCAGG + Intronic
961679300 3:128588275-128588297 CAGACCTGTGAGCTGTCGTAGGG + Intergenic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963603015 3:147393413-147393435 CAGTGCAGGGAGCTGGAGGGAGG - Intronic
964791817 3:160460253-160460275 CAGTCCTGCTGACTGGAGTAGGG - Intronic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
965566915 3:170129337-170129359 CATTACTGGGAGCTGGAGGAAGG + Exonic
966887891 3:184386781-184386803 GGGTCCTGGGATCTGGAGCAAGG + Intronic
967762202 3:193238974-193238996 CAGTCCTGGCAGTTGGTGTGAGG - Intergenic
968861525 4:3175299-3175321 GAGTCCAGGGAGCTGGGGCAAGG - Intronic
968905087 4:3447262-3447284 CAGGCATGGGAGCTGAAGTGCGG - Intronic
968943734 4:3652898-3652920 CAGACCTGGGAGGGGGAGTCTGG + Intergenic
969509220 4:7608103-7608125 CACCCCTGGGAGCTAGTGTATGG + Intronic
969608255 4:8212853-8212875 CAGGGATGGGAGCTGGAGTCAGG + Intronic
969633257 4:8350824-8350846 CTGTGCTGGGAGCTGGAGACAGG + Intergenic
970047793 4:11875869-11875891 CAATCCTGGGATCAGGAGGATGG + Intergenic
970663798 4:18314459-18314481 CAGTCCTGGATGCTGCATTAGGG + Intergenic
972203914 4:36747980-36748002 CAGTCCTAGAGACTGGAGTAGGG + Intergenic
972251261 4:37304835-37304857 CAATTCTGGGGGCTGGAGGATGG + Intronic
972642961 4:40942415-40942437 GAGTCCTGGGGTCTGGAGTCAGG + Intronic
973046624 4:45541716-45541738 CAATTCTGGGATCTGGAGGATGG - Intergenic
973703424 4:53558526-53558548 CAGTGATGGGTGCTGGAGGAAGG - Intronic
974573744 4:63689310-63689332 CCGTTCTGGGATCTGGAGAATGG - Intergenic
974981861 4:68966979-68967001 CAATTCTGGGATCTGGAGAATGG + Intergenic
976210941 4:82669095-82669117 CAGTCAAGGGAGATGGAGTCAGG + Intronic
977545090 4:98367488-98367510 CCGTCCTGGGGTCTGGAGGATGG - Intronic
977595879 4:98879433-98879455 TAGTCCTGTGAGATGAAGTATGG - Intronic
978353244 4:107842609-107842631 CAGTCATGGAAACTAGAGTAAGG + Intronic
978429691 4:108620690-108620712 CAGTCCTTTGAGCTGGTGTAGGG + Exonic
981399799 4:144301027-144301049 CATTCCTGGGAGCGGGACTGTGG - Intergenic
984851800 4:184160803-184160825 ATGTCCTGGAAGCAGGAGTATGG - Intronic
985016653 4:185643206-185643228 CTGTGCTGGGACCTGGAGGATGG + Intronic
985121835 4:186651359-186651381 CAGTCCTGAGAGCTGTACAATGG + Intronic
986443231 5:7799225-7799247 AGGACCTGGGGGCTGGAGTAGGG - Intronic
987317592 5:16738298-16738320 CAGGCCTGGGAGCAGGGGTGGGG + Intronic
988498950 5:31768098-31768120 CAGAACTGGGACCTGGAGTTAGG + Intronic
988542326 5:32121859-32121881 CAGTCTTGGGAGCTGGCAGATGG - Intergenic
994124387 5:96153227-96153249 CAGTCCTTAGACCTGGAGTCTGG + Intergenic
995527156 5:113059269-113059291 CTGTCCTGGAAGCAGGAGAAGGG - Intronic
997304739 5:132829169-132829191 GAGTCCTGGGAGGGGGAGTTGGG + Intronic
998143176 5:139711138-139711160 CAGCCCAGGGAGCTGGAGACAGG + Intergenic
998806492 5:145922144-145922166 CAGGCTTTGGGGCTGGAGTATGG - Intergenic
999239271 5:150118192-150118214 GGGACCTGGGAGATGGAGTAAGG - Intronic
1001395456 5:171416444-171416466 CATTCTTAGTAGCTGGAGTAAGG - Intergenic
1001889345 5:175326334-175326356 TAGTCCTGGGGGCTGGGGAAGGG - Intergenic
1002131457 5:177084472-177084494 CTGTCCTGGGAGCTCCAGCAAGG + Intergenic
1002445425 5:179287443-179287465 CAGTCGTGGGCTCTGGAGCAGGG - Intronic
1002569050 5:180129731-180129753 CAGTGGTGGGAGCTGGAGCCTGG - Intronic
1003072642 6:2957138-2957160 GACTCCTGGGGGCTGGAGAAAGG + Intronic
1003733719 6:8854316-8854338 GAGCCCTGGGAGTTGGAGGAAGG + Intergenic
1003959631 6:11197050-11197072 CAGTTCTGGGAGGTGGAATGAGG - Intronic
1005997455 6:30940055-30940077 CAGTGCCTGGGGCTGGAGTAGGG - Intergenic
1006288141 6:33113705-33113727 CAGCCCTGGGAACTGGAGAGGGG + Intergenic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1007639675 6:43328102-43328124 CAGTCCTTTGAGCTTGTGTAGGG + Intronic
1008650131 6:53553117-53553139 CCATCCTGGGATCTGGAGGACGG - Intronic
1012534326 6:100277639-100277661 CATTCCTGAGAGGTGGAGTTAGG + Intergenic
1013252748 6:108350496-108350518 AAATCCTGGGAACTGCAGTAGGG + Intronic
1014143578 6:117971431-117971453 CAGTTCTGGCATCTGGAGGATGG + Intronic
1016339680 6:143049518-143049540 CAGTCCTGCAGACTGGAGTAGGG - Intergenic
1017946456 6:159100138-159100160 CAGGGCTGCGAGCTGGAGTCAGG + Intergenic
1018904103 6:168065134-168065156 CAGCCCTGGGAGCTGGTGTGGGG - Intronic
1022596574 7:31718750-31718772 CAGACCTGGCAGCTGGACAAGGG + Intergenic
1023741743 7:43287326-43287348 CATTCCTGGCAGTGGGAGTAGGG + Intronic
1029056754 7:97753175-97753197 TACTCCTGAGAGCTGGAGTTAGG + Intergenic
1029545033 7:101206200-101206222 CCGTCCTGGGAGTTGGGGGATGG - Exonic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1032083707 7:128872841-128872863 AGATCCTGGGAGCTGGAGTTTGG + Intronic
1034348635 7:150402678-150402700 CAGTCCTGGGAGATGGGAGATGG + Intronic
1036387389 8:8294331-8294353 GAGTCCTGAAAGGTGGAGTATGG - Intergenic
1036494564 8:9258518-9258540 CAGTCCTGGAAGCTGGAGGGAGG + Intergenic
1038407977 8:27336040-27336062 GTGTCATGGGAGCTGGAGAATGG + Intronic
1038446785 8:27610176-27610198 GAGGCCTGGGAGCTGGGCTAAGG + Intronic
1038803405 8:30769443-30769465 TATTCCCGGGAGCTGGAGAAAGG + Intergenic
1039575089 8:38616706-38616728 CAGTCATGGAAGCTGAAATAGGG + Intergenic
1040303689 8:46201224-46201246 CAGTCCTGGGAGCTTCTGAATGG - Intergenic
1040370737 8:46770399-46770421 TACTCCTGAGAGCTGGAGTTGGG - Intergenic
1040450326 8:47539685-47539707 CAGTCCTGGGAAGTGGGGTTTGG + Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043340389 8:79230350-79230372 CAGTGCTGGGAGGTGGGGAAAGG + Intergenic
1044718609 8:95124080-95124102 CCATCCTGGGATCTGGAGAATGG - Intergenic
1046779768 8:118202578-118202600 CAGCCCTGTGTGCTGGAGTTAGG - Intronic
1047437809 8:124849278-124849300 CTGGCCTGGGTGCTGGAATATGG + Intergenic
1048329539 8:133462639-133462661 CATTCCTAGGGGCTGGAGTTTGG - Intronic
1049215408 8:141405566-141405588 CTGTCCTGTGAGTGGGAGTAAGG - Intronic
1049257994 8:141624151-141624173 CACTCCTGTGACCAGGAGTAGGG - Intergenic
1052972266 9:34384116-34384138 CAGTGCTGGGATTTGGAGTTCGG + Intronic
1053168481 9:35861356-35861378 CAGTGCTGGGCTCTGGAGAATGG - Intergenic
1055839540 9:80485991-80486013 GAGCCCTGGGACCTGGAGTATGG + Intergenic
1056119985 9:83478029-83478051 CAGTCCTGGGAAAATGAGTAGGG - Intronic
1056871125 9:90280321-90280343 CAGTTATGGGATCTGTAGTAAGG - Intergenic
1057546917 9:96026034-96026056 AGGTCCTGGAAGCTGGAGAAGGG + Intergenic
1057899908 9:98940499-98940521 CAGGCCTGGGAGCTGAAGTGGGG - Intergenic
1059372559 9:113854483-113854505 CAGACCTGAGAGCAGGACTAGGG - Intergenic
1060063508 9:120482597-120482619 CAGCTCTGGGGGCTGGAGGAGGG - Intronic
1060249824 9:121977104-121977126 GAATGCTGGGAGCTGGAGCAGGG + Intronic
1060838697 9:126777692-126777714 CCCTCCTGGGAGCTGGGGGAGGG + Intergenic
1060986158 9:127820091-127820113 CAGTCCTTGGTGCTGGGGTGTGG - Intronic
1061848184 9:133399917-133399939 AAGTCCTGGCACCTGGAGTGTGG - Intronic
1062041182 9:134405033-134405055 CTCTCCTGGGAGCGGGAGCAGGG + Intronic
1062339364 9:136087154-136087176 CAGCCTTGGGAGCTGGAGGGCGG + Intronic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1062643935 9:137536893-137536915 CTGTCGTGGGAGATGAAGTATGG - Intronic
1186208914 X:7229768-7229790 CACCCCTGGTAGCAGGAGTAGGG - Intronic
1186556018 X:10559660-10559682 CAGTCCTGAGAGATGGAGAAAGG - Intronic
1186657796 X:11633843-11633865 CAGAGCTGGGAGCTGGAGACAGG - Intronic
1188753783 X:33935913-33935935 CAATTCTGGGATCTGGAGGATGG + Intergenic
1189205284 X:39232955-39232977 CAGTTCTGGGAGTTGGAGGAAGG + Intergenic
1189612828 X:42754991-42755013 CATTCCTGGCAACTGGAGGAAGG + Intergenic
1190062344 X:47219282-47219304 CTGTCCTGGGAGCTGGGGTTGGG + Intronic
1190264154 X:48817542-48817564 AAGTCCTGGGAGCTGGACCATGG - Intronic
1191654785 X:63584952-63584974 GAGTCCTGGGCGCCTGAGTATGG + Intergenic
1191791485 X:64976502-64976524 GAGGCCTGGGAGCTGTAGTCCGG + Intronic
1191889917 X:65929184-65929206 CAGCCATAGGAGGTGGAGTAGGG + Intergenic
1192256948 X:69469467-69469489 CACTGGTGGGAGATGGAGTATGG + Intergenic
1193468741 X:81875425-81875447 TAGTCCTGTGGCCTGGAGTAAGG - Intergenic
1194023461 X:88723005-88723027 CATCTCTGGGTGCTGGAGTAGGG + Intergenic
1194205059 X:91002660-91002682 CAGTCCTGAGGACTGGAGTGGGG - Intergenic
1195223752 X:102771217-102771239 CAGAGCTGGGGTCTGGAGTATGG + Intergenic
1195232357 X:102862490-102862512 CTGTGCTGGGATCTGGAGGAGGG - Intergenic
1195390109 X:104352887-104352909 CAGTCTTGGGATCTGGGATAGGG + Intergenic
1199943149 X:152643257-152643279 CAGGCCTGGATGCTGGAGTCTGG + Intronic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1200055808 X:153460028-153460050 GAGACCTGGGAGTTGGAGGAGGG - Intronic
1200081578 X:153579367-153579389 CAGCCATGGGAGCTGGGGGATGG + Intronic
1200550887 Y:4577803-4577825 CAGTCCTGAGGACTGGAGTGGGG - Intergenic