ID: 904869427

View in Genome Browser
Species Human (GRCh38)
Location 1:33607460-33607482
Sequence AAGCTCTGACCACTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904869427_904869429 2 Left 904869427 1:33607460-33607482 CCTGGGGAGAGTGGTCAGAGCTT 0: 1
1: 1
2: 1
3: 19
4: 170
Right 904869429 1:33607485-33607507 TTACGAGGTGCCGCTCCGTACGG 0: 1
1: 0
2: 0
3: 0
4: 9
904869427_904869433 12 Left 904869427 1:33607460-33607482 CCTGGGGAGAGTGGTCAGAGCTT 0: 1
1: 1
2: 1
3: 19
4: 170
Right 904869433 1:33607495-33607517 CCGCTCCGTACGGCGGAGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 28
904869427_904869430 5 Left 904869427 1:33607460-33607482 CCTGGGGAGAGTGGTCAGAGCTT 0: 1
1: 1
2: 1
3: 19
4: 170
Right 904869430 1:33607488-33607510 CGAGGTGCCGCTCCGTACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 9
904869427_904869431 8 Left 904869427 1:33607460-33607482 CCTGGGGAGAGTGGTCAGAGCTT 0: 1
1: 1
2: 1
3: 19
4: 170
Right 904869431 1:33607491-33607513 GGTGCCGCTCCGTACGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 23
904869427_904869435 30 Left 904869427 1:33607460-33607482 CCTGGGGAGAGTGGTCAGAGCTT 0: 1
1: 1
2: 1
3: 19
4: 170
Right 904869435 1:33607513-33607535 GAAGGTGTAAACAGAGAGTGTGG 0: 1
1: 0
2: 1
3: 18
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904869427 Original CRISPR AAGCTCTGACCACTCTCCCC AGG (reversed) Intronic
900641390 1:3689572-3689594 CAGCTCTGCCCGCTCTCCCGGGG + Intronic
901485076 1:9553954-9553976 GAGCTCTGACCTTGCTCCCCTGG + Intronic
901800389 1:11704943-11704965 AAGCTCTGACCACGCACTCGTGG - Intronic
902637220 1:17742480-17742502 CTGCTCTGACCACTCACCCAGGG - Intergenic
902891034 1:19443856-19443878 AAGCTATGGGCTCTCTCCCCAGG + Intronic
904627226 1:31813992-31814014 AAGCTCAGACAACTCCCACCAGG - Exonic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
904989533 1:34580537-34580559 GAGCACTGGCCTCTCTCCCCTGG + Intergenic
906636917 1:47416205-47416227 AAGGCCTGAGCCCTCTCCCCCGG + Exonic
912262049 1:108120340-108120362 AAGCTCTCACCACTCTCCCCAGG + Intergenic
915015006 1:152724703-152724725 AATCTCTGTCCAGTTTCCCCGGG - Intergenic
915287353 1:154861521-154861543 ACACTCTGCCCCCTCTCCCCGGG + Intronic
915349094 1:155213417-155213439 GATCCCTGCCCACTCTCCCCAGG - Intronic
915352281 1:155234044-155234066 GATCCCTGCCCACTCTCCCCAGG - Intergenic
915594019 1:156886214-156886236 TAGCTCTGACCACAGGCCCCAGG - Intergenic
919922058 1:202171835-202171857 CTGCTCTGACCTCCCTCCCCTGG - Intergenic
919941415 1:202289043-202289065 ATACTCTCACCACCCTCCCCAGG - Intronic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
922169600 1:223143386-223143408 AACCTCTGCCTCCTCTCCCCGGG - Intergenic
923185068 1:231563790-231563812 AACCTTTCACCACTCTCCTCAGG - Intronic
1066193412 10:33076630-33076652 AAGCTCTGACCAGGCTTCCCAGG - Intergenic
1066352197 10:34646386-34646408 AAGTTTTCACCTCTCTCCCCAGG + Intronic
1073115008 10:101087032-101087054 TACCTCTGACCACTGCCCCCAGG - Intergenic
1074450242 10:113553518-113553540 AAGCTATAAACTCTCTCCCCAGG + Intronic
1074720069 10:116256627-116256649 AAGCAGTGCCCACTCACCCCAGG - Intronic
1076823335 10:132953139-132953161 CTGCTCTGACCAGTGTCCCCAGG - Intergenic
1077143392 11:1034648-1034670 GAGCTGTGACCGGTCTCCCCTGG + Intronic
1077647873 11:3942330-3942352 CACCTCAGACCACTCTGCCCAGG - Intronic
1079243491 11:18737141-18737163 AAGTTCTGACCCCAGTCCCCAGG - Intronic
1080125618 11:28729887-28729909 ATGATGTGACCACTCTCCTCTGG - Intergenic
1081566519 11:44264204-44264226 ATCCTCTGCCCACTCTCTCCAGG + Exonic
1081979446 11:47257511-47257533 AAGCTCTCCCCACTAGCCCCAGG - Intronic
1082008675 11:47436029-47436051 AGGTTCTGACCTCTCACCCCAGG + Intergenic
1082268518 11:50144642-50144664 TACCTCTCACCTCTCTCCCCCGG - Intergenic
1083265520 11:61545066-61545088 GAGCTGTGACCAGTCTCCCTTGG - Intronic
1084959755 11:72710218-72710240 AAGTTCTGACCACTTCCCCCAGG - Intronic
1085308000 11:75499254-75499276 AAGCACTGACCCCTCCCCTCAGG + Intronic
1086880989 11:92153025-92153047 AAGGCCTGAACACTCTACCCTGG + Intergenic
1089788448 11:120924834-120924856 AACCTCTGGCCACTCTTCCTGGG - Intronic
1090257456 11:125295336-125295358 TAGAGCTGACCACTCTCCCAAGG - Intronic
1091308939 11:134559399-134559421 ACCCTCTGACAACTCTCCCCGGG - Intergenic
1092112888 12:5976458-5976480 AAGCTATGACCAGTCTCTCAGGG + Intronic
1092165181 12:6337975-6337997 ATGGTCTGAAAACTCTCCCCCGG - Intronic
1095961284 12:47835718-47835740 GAGCTCTGCCCACTACCCCCAGG + Intergenic
1098515689 12:71374051-71374073 AAGTTCTGACAAGTGTCCCCTGG - Intronic
1102418128 12:112782096-112782118 AGTATCTGTCCACTCTCCCCAGG - Intronic
1103743237 12:123105481-123105503 AAGCTCTGTACACTGTCTCCAGG + Intronic
1103838600 12:123844598-123844620 AATCTCTGACCACACTGCCCAGG - Intronic
1104477671 12:129083951-129083973 AAGCTCTGAGCTCTCTGCCTTGG - Intronic
1104941350 12:132397066-132397088 CAGCTGTGGCCACCCTCCCCTGG + Intergenic
1104989229 12:132615733-132615755 ATGGGCTGTCCACTCTCCCCCGG + Intergenic
1105531488 13:21224683-21224705 CAGACCTGCCCACTCTCCCCTGG + Intergenic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1106122277 13:26870566-26870588 AACCACTATCCACTCTCCCCTGG + Intergenic
1108068587 13:46604303-46604325 AGGCTCTGACACCTCTCCTCTGG - Intronic
1108455731 13:50611888-50611910 CAGCTCTGGCCACTCCCTCCTGG - Intronic
1111822776 13:93233772-93233794 ACTCACTGACCAGTCTCCCCAGG - Intronic
1113929020 13:113956747-113956769 AAGCTCTGAGCACCCTCTCCGGG + Intergenic
1116861659 14:50000542-50000564 AAGTTCAGTCCACTCTCCCCAGG + Intronic
1117899360 14:60516022-60516044 AAGCTCTTACAAATCTCCTCTGG + Intergenic
1118681858 14:68249942-68249964 AAGGTCTCACCACCTTCCCCTGG - Intronic
1118765809 14:68908614-68908636 ACCCTCTGACCACACTCTCCAGG - Intronic
1118765818 14:68908648-68908670 ACCCTCTGACCACACTCTCCAGG - Intronic
1118900799 14:69983702-69983724 AAGCTCTGAGCCCTCTCACCTGG - Intronic
1120206321 14:81590944-81590966 AAGCTCTTACCATTTTCCACTGG - Intergenic
1121243476 14:92446759-92446781 TAGCTCTGACCACAAGCCCCTGG - Intronic
1122026316 14:98880102-98880124 CTGCTCTGTCCACTCTGCCCTGG + Intergenic
1122127894 14:99588949-99588971 AGTCTCTGACCAGTCTCCCCAGG - Intronic
1124633369 15:31349799-31349821 AAGCTGTGAACCCCCTCCCCAGG - Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128748901 15:70134517-70134539 AAGCGCTCGCCATTCTCCCCAGG + Intergenic
1130111318 15:80967826-80967848 AATCTTTGACCACTGTTCCCTGG - Intronic
1130727275 15:86452311-86452333 CAGTGCTGACCACTCTCACCTGG + Intronic
1131213615 15:90518797-90518819 AAGCTCTGATCACACTTCACTGG + Intergenic
1133591057 16:7243991-7244013 AAGCTATGAACATTCTCTCCAGG - Intronic
1134907214 16:17990237-17990259 ATACTCTGACCTCTCTCTCCAGG - Intergenic
1137547811 16:49416364-49416386 ATGCTCTGACCTCTCCTCCCAGG - Intergenic
1137606427 16:49789663-49789685 AGGCTTTGCCCCCTCTCCCCTGG - Intronic
1141456338 16:84144955-84144977 GAGCTCTCACCACGCCCCCCAGG - Intronic
1141616248 16:85211266-85211288 AAGCTGAGACCAGTCTCTCCTGG - Intergenic
1142767190 17:2071548-2071570 CAGCTCTGACCACCCTCACGGGG - Intronic
1145760947 17:27425306-27425328 AAGCTCTCATCACCCTCCCCAGG + Intergenic
1146807229 17:35874490-35874512 AAGCTCTTACCACGTTGCCCAGG + Intronic
1147656362 17:42093243-42093265 AAGCTCAGCCCACCCACCCCGGG - Intergenic
1148126409 17:45239501-45239523 CAGCTCTGCCCACCTTCCCCAGG - Intronic
1150807106 17:68328010-68328032 AAGCTGTGACCACCCCCTCCTGG - Intronic
1151095975 17:71498470-71498492 GAGCTCTGTCTACTCCCCCCAGG + Intergenic
1154405238 18:14084580-14084602 AAGCTCTGCCCACCCTCCCCTGG - Intronic
1157195779 18:45619226-45619248 AAGCTGAGCCCAGTCTCCCCAGG + Intronic
1158583435 18:58706298-58706320 AGGCTCTTACCACTGTGCCCGGG + Intronic
1160764594 19:801817-801839 TGGCTCTGACCCCTTTCCCCTGG + Intronic
1162800479 19:13107650-13107672 AACCTCTGACCTCTGCCCCCAGG - Exonic
1164247180 19:23441403-23441425 AAGCTGTGTTCATTCTCCCCTGG + Intergenic
1164615710 19:29665720-29665742 GACCCCTGACCGCTCTCCCCAGG - Intronic
1164984673 19:32639603-32639625 AAGCTACGACCACCATCCCCTGG + Intronic
1165045911 19:33104725-33104747 AAGCACTGACCCCTCTCTCCCGG - Intronic
927247980 2:20973433-20973455 TAGCTCTGACCACTGTTCTCAGG - Intergenic
928392638 2:30921128-30921150 AAGGCCTGACAACTCTCCTCAGG + Intronic
928743245 2:34380790-34380812 AAGCTGTGTCCATTCTCCCCTGG + Intergenic
929597756 2:43186911-43186933 AGCCTCTTACCACTTTCCCCAGG - Intergenic
930804224 2:55473972-55473994 ACCCTCCGGCCACTCTCCCCCGG - Intergenic
932209005 2:69911700-69911722 AATCTCTGCCCAGTCTCCTCTGG - Intronic
934161979 2:89258342-89258364 ATGCTCTGGCAACTCTCCTCAGG - Intergenic
934205303 2:89924020-89924042 ATGCTCTGGCAACTCTCCTCAGG + Intergenic
935019380 2:99215371-99215393 CAGCTCAGCCCACTCTCCACAGG + Intronic
942875447 2:180790296-180790318 ATGTCCTGACCACTTTCCCCAGG + Intergenic
944422089 2:199542202-199542224 GAGCACTGACCAATCTCCTCAGG - Intergenic
947464187 2:230326608-230326630 AGGCTAAGAACACTCTCCCCAGG + Intergenic
947528122 2:230891775-230891797 AAGCTCTGAGCCTTCACCCCAGG - Intergenic
948916856 2:241038862-241038884 AAGCTCTGCCCAGTCACCCTTGG - Intronic
1168926168 20:1581319-1581341 AAGCTGTGAGCACCCTGCCCAGG + Intronic
1168930030 20:1614367-1614389 AAGCTGTGAGCACCCTGCCCAGG + Intronic
1170528298 20:17263027-17263049 CAGCTCAGACCACCCTCCCTGGG - Intronic
1170632770 20:18079644-18079666 CAGCTGAGACCACTCACCCCTGG + Intergenic
1172088246 20:32406704-32406726 AAGCTCTGACCAGTCACATCAGG + Intronic
1172446911 20:34998017-34998039 GACCTCTGACCATTGTCCCCAGG + Intronic
1172554937 20:35832602-35832624 AATCCCTGCCCACTCTTCCCAGG - Intronic
1175974412 20:62703188-62703210 AGGCTCTGTCTCCTCTCCCCAGG - Intergenic
1177648618 21:23932312-23932334 AGTCTCTGACCACTCTACCTGGG - Intergenic
1183474903 22:38030811-38030833 AACCACTGACCACGCTCCCCAGG - Intronic
1185187027 22:49407325-49407347 AGGCTCTGTCCAGTCTCCTCTGG - Intergenic
950650123 3:14402112-14402134 AAGCTCAGGCCACCCTCCCGGGG + Intergenic
950740132 3:15044156-15044178 AGGCCCTAACCACTCTCGCCAGG - Exonic
953964896 3:47296725-47296747 GGCCTCTGAACACTCTCCCCTGG - Intronic
954111877 3:48438361-48438383 CAGCGCAGACCTCTCTCCCCAGG + Intronic
955054770 3:55445532-55445554 AAATTTTCACCACTCTCCCCAGG + Intergenic
956745887 3:72310789-72310811 CTGCTCTGCCAACTCTCCCCTGG - Intergenic
961317853 3:126052689-126052711 CAGCTCTGTACCCTCTCCCCTGG + Intronic
961537532 3:127579116-127579138 CAGCCCTGACACCTCTCCCCAGG + Intronic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
962867583 3:139460553-139460575 AAGCTCTGACTCCTCTCCTGGGG - Intronic
964737220 3:159929350-159929372 AAGCTCTGTCCCTCCTCCCCAGG - Intergenic
966625135 3:182007621-182007643 AAACGTTGACCACTCTCCTCAGG - Intergenic
968946358 4:3666693-3666715 GAGCTCTCAGCAGTCTCCCCTGG - Intergenic
969582218 4:8072028-8072050 CAGCTCTGAGCATCCTCCCCGGG - Intronic
969630813 4:8334928-8334950 GAGCACTGACCACTCACCCAAGG - Intergenic
974166540 4:58212087-58212109 AAAAACTGACCACTCTCTCCAGG + Intergenic
977551427 4:98447811-98447833 AAGCCCTCCCCACTCTCCCGAGG + Intergenic
979539093 4:121858997-121859019 AAACTCTGAGCACTCTGTCCTGG + Exonic
979738571 4:124119944-124119966 AAGCTGTGAAGACACTCCCCAGG + Intergenic
980458622 4:133076383-133076405 AAGCTCTCTCAACTCTCCCTTGG + Intergenic
981691313 4:147512774-147512796 AAGCTCTAAGCAATCTTCCCTGG - Intronic
983917446 4:173307825-173307847 AAGCTCTGCCAATTCTCCCATGG - Intronic
986398611 5:7356442-7356464 AAGATCACACCACTCTACCCTGG - Intergenic
986745024 5:10736337-10736359 AAGTTCTGCCCACTCTAACCTGG + Intronic
991457099 5:66815852-66815874 AACCTGTCACCACTCTCCTCTGG - Intronic
997213674 5:132093556-132093578 AGGCTCTGACCCATCTGCCCAGG - Intergenic
1000890230 5:166793004-166793026 AAGCTCTGACCAGGGTCCTCTGG + Intergenic
1001057987 5:168465027-168465049 GAGCTCTGGCCTCTCTTCCCCGG - Intronic
1001585788 5:172833305-172833327 GAGCCCTCACCATTCTCCCCTGG + Intergenic
1001723790 5:173879187-173879209 AAACTCTCACCACTCTCACTTGG + Intergenic
1006627613 6:35408513-35408535 AGTCCCTGACCACTCGCCCCTGG - Intronic
1006815318 6:36845903-36845925 CAGCCCGGACCACTCTCCCCTGG + Intergenic
1011215939 6:85005652-85005674 TAGCTCTGCCCACTTTCCCCGGG - Intergenic
1012836802 6:104279873-104279895 AACCACTGACCTCTCTCCCTTGG + Intergenic
1017313511 6:153002391-153002413 GTGCTCTGACGCCTCTCCCCCGG + Intronic
1017804439 6:157931601-157931623 AAACTCAGACCCCTCTTCCCTGG + Intronic
1018668848 6:166163298-166163320 AAGCTCCCCCCATTCTCCCCAGG + Intronic
1019449289 7:1088475-1088497 AGGCACAGACCCCTCTCCCCCGG + Intronic
1020213702 7:6173038-6173060 AAGCCCTGCCTCCTCTCCCCCGG + Intronic
1020997017 7:15278327-15278349 GGCATCTGACCACTCTCCCCGGG - Intronic
1021551448 7:21875461-21875483 AAACTGTGGACACTCTCCCCAGG + Intronic
1022263242 7:28727775-28727797 GGGCTCTGACCACTCTGCCCAGG + Intronic
1022505749 7:30907916-30907938 AGGCTCCGTCCACTCTCCTCCGG + Intergenic
1022639765 7:32170880-32170902 CACCCCTGACCACTCTCCACTGG + Intronic
1023650078 7:42360060-42360082 AAGCCCTGAGCTCTCTCCACGGG + Intergenic
1023828816 7:44027853-44027875 AAGCCCTGCCCACCCTGCCCCGG + Intergenic
1024090926 7:45939223-45939245 ATGCTCTGACCAGGCGCCCCGGG + Intergenic
1026593433 7:71715029-71715051 ATGCTCTGAGCAGTCTCCCCAGG - Intergenic
1029102358 7:98142604-98142626 AAGCTCTGAGAAGTCTCTCCAGG - Intronic
1029405540 7:100372477-100372499 AGGCTCTGCCCACCCTCTCCAGG - Intronic
1029739115 7:102482110-102482132 AAGCCCTGCCCACCCTGCCCCGG + Intergenic
1029757116 7:102581289-102581311 AAGCCCTGCCCACCCTGCCCCGG + Exonic
1029852806 7:103482326-103482348 AAGCTGTCACCACTCTCACCTGG - Intronic
1038476903 8:27875049-27875071 AAGCCCTGACAGCTCTCCCAGGG - Intronic
1039162282 8:34635401-34635423 AACCTCTGCCCTCTGTCCCCTGG - Intergenic
1041114797 8:54525042-54525064 AGGCTCTGTCCACACCCCCCAGG - Intergenic
1044996864 8:97845685-97845707 AAGCTCTAGACACCCTCCCCAGG + Intronic
1045483786 8:102614296-102614318 AACCTCTGACCACTCCCCTTGGG + Intergenic
1047518550 8:125576443-125576465 AATCTCTGACCAGTCAGCCCCGG - Intergenic
1051126436 9:13810742-13810764 CAGCTGTGCCCACTCTCCTCTGG + Intergenic
1051675744 9:19556621-19556643 AAGTTCTTACATCTCTCCCCCGG + Intronic
1055937446 9:81616092-81616114 AAGCCCTGCCCACTCGCCCCGGG - Exonic
1056432450 9:86541129-86541151 TAGCTCTGACCAGTTTCCCTTGG + Intergenic
1057759669 9:97861958-97861980 AAGCCCTGAGCACAGTCCCCAGG - Intergenic
1057770831 9:97966528-97966550 AAGCTCTCACCACACACCTCAGG - Intergenic
1061596358 9:131632100-131632122 AATCTCTCACCTCTCTCACCTGG - Intronic
1062243693 9:135552727-135552749 AAGCTCTGTCCACTCCTGCCCGG + Intergenic
1185930840 X:4201971-4201993 AAAATCTCACCACTCTCCTCTGG - Intergenic
1187443721 X:19343124-19343146 CCGTTCTGACCACTGTCCCCTGG + Intergenic
1198226017 X:134646777-134646799 AAGCTGAGCTCACTCTCCCCTGG - Intronic
1199571446 X:149270792-149270814 AAGCTATGACCACCTTCTCCCGG - Intergenic