ID: 904869823

View in Genome Browser
Species Human (GRCh38)
Location 1:33609549-33609571
Sequence TGTCTATAGCCTCCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904869823_904869825 4 Left 904869823 1:33609549-33609571 CCTGGGTTTGGAGGCTATAGACA 0: 1
1: 0
2: 1
3: 12
4: 153
Right 904869825 1:33609576-33609598 GAGCTTTGGCCTTACTTGTAAGG 0: 1
1: 0
2: 1
3: 6
4: 95
904869823_904869824 -10 Left 904869823 1:33609549-33609571 CCTGGGTTTGGAGGCTATAGACA 0: 1
1: 0
2: 1
3: 12
4: 153
Right 904869824 1:33609562-33609584 GCTATAGACAAAGAGAGCTTTGG 0: 1
1: 0
2: 2
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904869823 Original CRISPR TGTCTATAGCCTCCAAACCC AGG (reversed) Intronic
901825021 1:11855651-11855673 TGTCTAATGCTTCCAAACCGGGG - Intergenic
902422155 1:16289327-16289349 TGACTATAGCCTCAAACCCCTGG - Intronic
904122323 1:28207937-28207959 TGCCTGTAGCCTGCAATCCCAGG + Intronic
904391670 1:30190102-30190124 TTCCTATATCCCCCAAACCCAGG + Intergenic
904869823 1:33609549-33609571 TGTCTATAGCCTCCAAACCCAGG - Intronic
906557345 1:46724315-46724337 TGTCTTTAGCATCCAAAACAGGG + Intergenic
909786258 1:79617695-79617717 TGTCATTACCCTCCAGACCCAGG + Intergenic
911693382 1:100860771-100860793 TGCCCTTAGCCTCCAACCCCCGG - Intergenic
912974995 1:114321446-114321468 CATCTATAGCCTCTAAGCCCCGG - Intergenic
920119068 1:203642154-203642176 TCTCTGTAGCCTCCAACTCCTGG + Intronic
924712620 1:246543066-246543088 TCACTACAGCCTCCAATCCCCGG + Intronic
924796130 1:247293531-247293553 TCACTATAGCCTCCAACTCCTGG - Intergenic
1063213285 10:3900779-3900801 TCACTACAGCCTCCAAATCCTGG - Intergenic
1065217540 10:23463822-23463844 TCACTATAGCCTCCAATTCCTGG - Intergenic
1068036210 10:51763304-51763326 TCACTACAGCCTCCAAATCCTGG + Intronic
1069209623 10:65740099-65740121 TGTCTATCAGCTACAAACCCAGG + Intergenic
1071768788 10:88700942-88700964 TCACTATAGCCTCCAACTCCTGG + Intergenic
1072147719 10:92657179-92657201 TGACTGTAGCCTCAAACCCCTGG - Intergenic
1072798914 10:98378346-98378368 TCACTGTAGCCTCCAACCCCTGG + Intergenic
1073030587 10:100522419-100522441 TCTCTGTAGCCTCAAACCCCTGG - Intronic
1073190057 10:101644692-101644714 TGTCTAGAAACTCCAAAACCAGG + Intronic
1073797319 10:107002545-107002567 TTTCTATAGCTCCCAAAACCTGG + Intronic
1078225625 11:9389126-9389148 TCACTGTAGCCTCCAATCCCAGG + Intronic
1079152649 11:17914491-17914513 TGACTGCAGCCTCCAAATCCTGG + Intronic
1082862021 11:57866191-57866213 TTTCTATCTCCTCCAAAACCAGG + Intergenic
1087306957 11:96499840-96499862 CGTCTGGAACCTCCAAACCCAGG + Intronic
1088343819 11:108800010-108800032 TCACTATAGCCTCCAATTCCTGG + Intronic
1092917411 12:13201331-13201353 TGACTACAGCCTCAAAGCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097251267 12:57633286-57633308 AGTCCTTAGCCTCCAAACACTGG + Exonic
1097475914 12:60055846-60055868 TGTGTATACCATCCAAACCAAGG + Intergenic
1101317482 12:103642844-103642866 TGGCCATATCCTCCATACCCTGG - Intronic
1101438674 12:104686155-104686177 TCACTATAGCCTCCAAACTCGGG - Intronic
1102491855 12:113294157-113294179 TCACTGTAGCCTCCAACCCCTGG + Intronic
1104326545 12:127804315-127804337 TGTCTAAAGCCTCCTTACTCTGG + Intergenic
1104394136 12:128417216-128417238 TGTCTCCAGCTTCCAAAGCCAGG - Intronic
1105817337 13:24049080-24049102 TGTCTAAAGTCTTCTAACCCTGG + Intronic
1118944659 14:70373207-70373229 GGTCTAGAGTCTACAAACCCAGG - Intronic
1120499459 14:85276837-85276859 TGTCTCTAGCCTGCAAATTCTGG + Intergenic
1121221900 14:92291895-92291917 TGTCTATGGAATCCAAAGCCAGG - Intergenic
1121357673 14:93229666-93229688 ACTCTATAGCCTCCAACTCCTGG - Intergenic
1122150738 14:99724832-99724854 TGTCCTTGGCCTCCAAACACTGG - Intronic
1127099167 15:55546975-55546997 GTACTATAGCCTCCAAAGCCAGG + Exonic
1127387999 15:58482801-58482823 TTTCAAAAGCCCCCAAACCCAGG - Intronic
1127707723 15:61563663-61563685 TGCCTATGGCCGCCACACCCAGG - Intergenic
1128069259 15:64783925-64783947 TCTCTATAGCCTCCACTTCCAGG - Intergenic
1132300027 15:100769430-100769452 TGTCTTTAGTCTCCAACTCCAGG - Intergenic
1133692294 16:8228571-8228593 TCTATGTATCCTCCAAACCCAGG - Intergenic
1134007914 16:10830590-10830612 TCTCTACAGCCTCCAATTCCTGG + Intergenic
1135873619 16:26176249-26176271 TTTCCATAACCTCCATACCCTGG + Intergenic
1137291137 16:47052677-47052699 TCACTATAGCCTCCAACTCCTGG - Intergenic
1143655764 17:8292753-8292775 TGTCTCTAGGCTCCAGCCCCAGG + Intronic
1144787808 17:17841532-17841554 TGTCCAGGGCCTCCAAGCCCAGG - Intergenic
1145093392 17:20004180-20004202 TGACTATAACCTCCAAATCCTGG - Intergenic
1151078254 17:71299205-71299227 TGACTAAAGCCACTAAACCCAGG + Intergenic
1152039019 17:77891273-77891295 GCACTATAGCCTCTAAACCCTGG + Intergenic
1152944373 17:83191092-83191114 AGTCTATGGCCTGCAAACCAAGG - Intergenic
1153218722 18:2844188-2844210 TCACTATAGCCTCCAACTCCTGG - Intergenic
1154065306 18:11102019-11102041 AGTCTATAGCCTCCAAATCAGGG - Intronic
1155021694 18:21902551-21902573 TCCCTGCAGCCTCCAAACCCTGG + Intergenic
1156214352 18:34980464-34980486 TGTCTGTAGCCCCCAAAGCAGGG + Intronic
1156690927 18:39706479-39706501 TCACTATAGCCTCCAACTCCTGG - Intergenic
1157822685 18:50785144-50785166 TCTCTATAGCCTCCACCTCCTGG - Intergenic
1158726432 18:59977278-59977300 TCACTATAGCCTCGACACCCAGG + Intergenic
1162329848 19:10021097-10021119 TGTCTGCAGCCTCCAACTCCTGG - Intronic
1162866589 19:13552446-13552468 TCACTATAGCCTCCAACTCCTGG + Intronic
1163641001 19:18461928-18461950 TGTCTATAGTCTCAAACCTCTGG - Intronic
1164758283 19:30707382-30707404 TGTCCTTCGCCTCCCAACCCAGG + Intronic
1167791837 19:51688207-51688229 TGACTAGAGCCTCCGAAGCCAGG - Intergenic
926682014 2:15671266-15671288 TGTCCACAGCCTCCCAGCCCGGG - Intergenic
928195738 2:29215351-29215373 TGTCTACCTCCTCCAGACCCAGG - Intronic
928873531 2:36010438-36010460 TGTCTACAGCCTCAAACTCCTGG - Intergenic
935146691 2:100400312-100400334 TCACTATAGCCTCCAACTCCTGG + Intronic
938541995 2:132290817-132290839 TCACTATAGCCTCCAATCCCTGG + Intergenic
939326255 2:140693390-140693412 TCACTATGGCCTCAAAACCCTGG + Intronic
939922398 2:148132837-148132859 TAGCTATAGCCTACAAAACCAGG - Intronic
943121176 2:183737877-183737899 TTTCTATGGCCTCAAATCCCTGG - Intergenic
944202359 2:197121195-197121217 TTCTTATAGCCTCCAAATCCAGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
947996098 2:234529182-234529204 TGTCATTTGCCTCCAAACCCTGG - Intergenic
948873682 2:240816660-240816682 TCTCTAAAGCCTCCTCACCCTGG - Intronic
1171870875 20:30523692-30523714 TCACTATAGCCTCCAATCCCTGG + Intergenic
1175990410 20:62785787-62785809 TGCCTAAGGCCTCCAAGCCCCGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180021140 21:45127959-45127981 GGCCTGTAGCTTCCAAACCCGGG + Intronic
1181306559 22:21920443-21920465 TGTCTTCAGCCTCCAACCTCCGG - Exonic
951245939 3:20341811-20341833 TCACTGTAGCCTCCACACCCTGG + Intergenic
953074665 3:39557631-39557653 TCACTGCAGCCTCCAAACCCTGG + Intergenic
953323106 3:41989908-41989930 TCTCTGCAGCCTCCAAACCCTGG + Intergenic
953387238 3:42513563-42513585 TGTCCATTGCCCCCAAACCTGGG - Intronic
953445085 3:42956641-42956663 TATCTAGTGCCTCCAAACTCAGG - Intronic
954431882 3:50475245-50475267 GGTATATAATCTCCAAACCCTGG + Intronic
957709978 3:83843741-83843763 ATTCTACAGCTTCCAAACCCAGG + Intergenic
958797783 3:98724332-98724354 TGACTATAGCCTCCAAATCCTGG - Intergenic
961795551 3:129406297-129406319 TGTCTCTGCCCTCCCAACCCAGG + Intronic
967736205 3:192955210-192955232 AGTCTATAGACTTTAAACCCTGG - Intergenic
969077340 4:4590484-4590506 GGTCTCCTGCCTCCAAACCCAGG + Intergenic
969230976 4:5831021-5831043 TCACTATAGCCTCCAAGTCCTGG + Intronic
969365442 4:6691401-6691423 TCACTATAGCCTCCAACTCCTGG - Intergenic
972264520 4:37446250-37446272 TGTGGCGAGCCTCCAAACCCTGG - Exonic
975059741 4:69983161-69983183 TCTCGATATCCTCCAGACCCTGG + Intergenic
976850686 4:89541818-89541840 TGTCTATGGCCTCAGACCCCAGG + Intergenic
978817119 4:112920125-112920147 TGTCTCTTGCCTCTAAGCCCAGG + Intronic
979359053 4:119740504-119740526 TCACTGCAGCCTCCAAACCCTGG + Intergenic
981254371 4:142644122-142644144 TCACTATAGCCTCCAACCCTTGG - Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982470765 4:155787226-155787248 TATATATAACCTACAAACCCCGG - Intronic
984264377 4:177479107-177479129 TGTCTGAAGCCTCCAAAGTCAGG - Intergenic
984925142 4:184799879-184799901 TGGCTTGAGCCTCTAAACCCAGG - Intronic
985390684 4:189489347-189489369 TGTCTTTGGCTTCCAAACACTGG - Intergenic
985905914 5:2836374-2836396 TGTCTAGAGCCTCCAAAACAAGG - Intergenic
987080908 5:14424532-14424554 TGACTTGAGCCTCTAAACCCAGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
989176698 5:38534666-38534688 TGTGTATGGCCTCCACTCCCTGG - Intronic
990427258 5:55698860-55698882 TCACTGTAGCCTCCAAATCCTGG - Intronic
993097358 5:83494900-83494922 TCGCTACAGCCTCCACACCCTGG - Intronic
995627594 5:114096307-114096329 TGTCTTTAACCTCCAAACCATGG - Intergenic
997521484 5:134526693-134526715 TGTGCAGAGCCTCCAACCCCAGG - Intronic
999251776 5:150186803-150186825 AGTCCATAGACTCCTAACCCTGG + Intergenic
1000942579 5:167380183-167380205 TCTCTATAGCTTCCAATACCTGG - Intronic
1001242206 5:170079493-170079515 TTTCTATAGCCCCCAGCCCCAGG + Intronic
1001407001 5:171483595-171483617 TGTCCACAGCCTCCAACCCTCGG + Intergenic
1001996513 5:176164753-176164775 TTTCTGTAGCCTCCAACTCCTGG + Intergenic
1007187796 6:39987209-39987231 TGACTGTAGCCTCCAGAGCCAGG + Intergenic
1008628316 6:53339419-53339441 TGTCTATAGCCTGAACACCATGG + Intronic
1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG + Intergenic
1015640245 6:135324251-135324273 TCACTGCAGCCTCCAAACCCTGG - Intronic
1016279241 6:142395405-142395427 TGGCTATATCTACCAAACCCAGG - Intronic
1016444966 6:144121963-144121985 TGGCTATAACCTCCAAAGCAGGG - Intergenic
1019927942 7:4205718-4205740 TGTCTAAGGCCTCCTAAGCCAGG + Intronic
1024634867 7:51278692-51278714 TGACTCAAGCCTCCAAATCCAGG + Intronic
1024696275 7:51859725-51859747 TAATTACAGCCTCCAAACCCTGG + Intergenic
1026518020 7:71089540-71089562 TGGCTAAAACCACCAAACCCAGG + Intergenic
1026908814 7:74080749-74080771 TCACTAGAGCCTCCAAATCCTGG + Intergenic
1030066726 7:105665224-105665246 TGTCTCCAGCCTCCAATCCCAGG - Exonic
1030888821 7:114972194-114972216 TGACTCTAGCATTCAAACCCCGG + Intronic
1035585732 8:771975-771997 TCACTATAGCCTCCAACTCCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037965339 8:23129649-23129671 CGTCTTTAGCCTCCAATCTCTGG - Intergenic
1037977084 8:23221360-23221382 TGTCTTCAGCCTCCAATCTCTGG + Intronic
1038236795 8:25766539-25766561 TCGCTATAGCCTCAAACCCCTGG + Intergenic
1038291499 8:26253459-26253481 TCACTATAGCCTCAAACCCCTGG - Intergenic
1038362326 8:26893111-26893133 TCACTATAGCCTCAAAATCCTGG - Intergenic
1038481748 8:27906772-27906794 TCACTATAGCCTCCAACTCCTGG + Intronic
1039124296 8:34183781-34183803 GATCTCTTGCCTCCAAACCCAGG - Intergenic
1039902803 8:41765610-41765632 TGGGCACAGCCTCCAAACCCAGG - Intronic
1042423515 8:68619946-68619968 TTTCTATACCCTACACACCCAGG - Intronic
1042538205 8:69880552-69880574 AGTCTAAAGCCCCCAAAACCAGG - Intergenic
1043153535 8:76748507-76748529 TGACTGTAGCCTCCAAGTCCTGG + Intronic
1043401068 8:79884882-79884904 TGTCTATAACCCCCCACCCCTGG - Intergenic
1043764193 8:84108602-84108624 TGTCAATATCCTCAAAAACCAGG - Intergenic
1045609879 8:103826754-103826776 TGACTACAGCCTCCAACTCCTGG + Intronic
1051084601 9:13333886-13333908 TCTCTATAGCCTCCAAATTAAGG + Intergenic
1052675667 9:31619552-31619574 TGTTTACACCCTCCACACCCTGG - Intergenic
1055182819 9:73409560-73409582 TGACTATAACCTCCAACTCCAGG - Intergenic
1055997967 9:82182215-82182237 CTTCTATTGCCTCCAAATCCTGG - Intergenic
1056434085 9:86558537-86558559 TGTCTACAGCCTCAACACTCTGG - Intergenic
1057278173 9:93687260-93687282 TGTCTATGGCCCCCATCCCCTGG + Intergenic
1059823283 9:117997640-117997662 TCACTGTAGCCTCTAAACCCTGG + Intergenic
1060631908 9:125166972-125166994 TGACTATAGCCTCAAACTCCTGG + Intronic
1185539042 X:887558-887580 TCACTATAGCCTCCAACTCCTGG + Intergenic
1186049014 X:5569550-5569572 TGACTGTAGCCTCCAACTCCTGG + Intergenic
1186638714 X:11432446-11432468 TTTTTATAGGGTCCAAACCCAGG + Intronic
1187422992 X:19152598-19152620 TCACTATAGCCTCCAAATCCTGG - Intergenic
1197001377 X:121443441-121443463 GGTCTATAGCATTCAAACTCTGG - Intergenic
1201637421 Y:16139783-16139805 TCACTGTAGCCTCCAAATCCTGG + Intergenic