ID: 904869916

View in Genome Browser
Species Human (GRCh38)
Location 1:33610419-33610441
Sequence CCACATCCACAGGTGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904869910_904869916 9 Left 904869910 1:33610387-33610409 CCATGTACAGCTGCACAGGTTGG 0: 1
1: 4
2: 7
3: 47
4: 222
Right 904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG 0: 1
1: 0
2: 2
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904869916 Original CRISPR CCACATCCACAGGTGATGGA TGG Intronic
900923787 1:5690559-5690581 CCACATTCACAGGTCCTGGGGGG - Intergenic
901953679 1:12769102-12769124 CCACATCCAAAGGAGAGAGAGGG + Intergenic
902013675 1:13289398-13289420 CCACATCCACAGGACAGAGAGGG - Intergenic
902359306 1:15933545-15933567 CCTCATCCACCGGTGCTGGCTGG - Exonic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905184041 1:36183533-36183555 CCACATGCACAGGCTGTGGATGG + Intergenic
906707912 1:47908477-47908499 CCACCTCCAGAGTTGATGCAAGG + Intronic
907947630 1:59150179-59150201 CCAGTTCCACTGGTGGTGGAAGG - Intergenic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
911333273 1:96550167-96550189 CCACAGTCACTGGTGATGAAGGG - Intergenic
917290977 1:173471788-173471810 ACAATTCCACACGTGATGGAAGG + Intergenic
917498215 1:175562023-175562045 CTTCTTCCACAGGTGATGGCAGG - Intronic
918362192 1:183770940-183770962 CCTCATCCACAGGGGAGGGAGGG - Intronic
920346902 1:205311948-205311970 CCACCTACACTGGTGAAGGATGG - Intronic
920537358 1:206747086-206747108 TCACATTCACAGGTACTGGAGGG + Intergenic
1062837773 10:647431-647453 CCACATCCACATTGGATGGTGGG + Intronic
1062837854 10:647924-647946 CCACGTCCACATTTGATGGCGGG + Intronic
1062837913 10:648280-648302 CCACATCCACATTGGATGGTGGG + Intronic
1062837937 10:648460-648482 CCACGTCCACATTTGATGGTGGG + Intronic
1062837946 10:648505-648527 CCACATCCACATTGGATGGTGGG + Intronic
1062838016 10:648955-648977 CCACGTCCACATTTGATGGTGGG + Intronic
1062838025 10:649000-649022 CCACATCCACATTTGAGGGTGGG + Intronic
1062838061 10:649225-649247 CCACGTCCACATTTGATGGTGGG + Intronic
1063269675 10:4493882-4493904 ACACATGGATAGGTGATGGATGG - Intergenic
1065912352 10:30319714-30319736 CAAAAACCATAGGTGATGGAAGG + Intronic
1066102564 10:32130864-32130886 CCAGGTCCAGAGGTGAGGGAAGG + Intergenic
1066789338 10:39045550-39045572 CCACATCCACAGTAGAGGGTGGG + Intergenic
1067106577 10:43370852-43370874 CCTCCCCCACAGGTGAGGGATGG - Intergenic
1069413615 10:68178336-68178358 CAAGATCCACTGGTGATGAATGG - Intronic
1069984939 10:72276603-72276625 GCACACACACAGGTGAGGGAAGG + Intergenic
1070529355 10:77323211-77323233 TCCCATCCACATCTGATGGAAGG + Intronic
1071727025 10:88209229-88209251 TCACATTCACAGGTTCTGGATGG - Intergenic
1073862731 10:107766217-107766239 TCCCATCCACAGGTGATGTTGGG - Intergenic
1076497487 10:130906391-130906413 CCATGTCCATAGTTGATGGAAGG - Intergenic
1076677588 10:132155438-132155460 TCACATCCACAAGTGCAGGAAGG - Intronic
1077295471 11:1824454-1824476 CCACACTCACAGGTGAGGGCTGG + Intergenic
1077795279 11:5485119-5485141 CCTCCACCAAAGGTGATGGAAGG + Intronic
1080617973 11:33961508-33961530 CCACATCCACTGTTTATGGCTGG - Intergenic
1080863033 11:36166949-36166971 TCACATACACAGGTGCTGGGTGG - Intronic
1081905132 11:46664396-46664418 CCATACCCAGGGGTGATGGAGGG + Intronic
1082871397 11:57946194-57946216 CCACCTGCAAAGGAGATGGATGG + Intergenic
1088067050 11:105732275-105732297 CCACATCCCCAGGCAAAGGAAGG - Intronic
1089300791 11:117497632-117497654 CCACCTCCACCGCTGCTGGAGGG - Intronic
1090078573 11:123595030-123595052 CCACACCCAAAGGGGAGGGAGGG - Intronic
1093882098 12:24416357-24416379 CCACTTCCTCAGGCAATGGAGGG + Intergenic
1097356717 12:58610532-58610554 CCACACTCACAGGTAATGTATGG - Intronic
1098613656 12:72494607-72494629 CTACAGTCACTGGTGATGGATGG - Intronic
1102862949 12:116352230-116352252 CCCCACCCACAGGTGAAAGAAGG + Intergenic
1106227823 13:27798181-27798203 CCAAATCTACAGCTGAGGGAGGG + Intergenic
1107825998 13:44329797-44329819 CCACATCTTCAGTTCATGGATGG + Intergenic
1107851092 13:44574322-44574344 CCACATTTACAGGCGATGGCTGG + Exonic
1107851183 13:44575342-44575364 CCACAGCAACATGAGATGGATGG + Exonic
1108152392 13:47549950-47549972 TCATATCCCCAGGTGAGGGATGG + Intergenic
1113890634 13:113733359-113733381 CCACGTCCCCTGGTGCTGGAGGG + Intronic
1114634844 14:24181700-24181722 CCAGAGCCCCAGGTGAGGGAGGG - Exonic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1122034984 14:98941426-98941448 CCTCATCCACATGACATGGATGG + Intergenic
1123131581 14:105990083-105990105 CCACAGCCACAGGTTATTGAAGG - Intergenic
1123581814 15:21721269-21721291 CCACAGCCACAGGTTATTGAAGG - Intergenic
1123618463 15:22163869-22163891 CCACAGCCACAGGTTATTGAAGG - Intergenic
1124042283 15:26116511-26116533 CCACATCCAAGGCTGATGGCCGG + Intergenic
1124338419 15:28874323-28874345 CCACATTCACAGCTACTGGAGGG + Intergenic
1124636527 15:31368147-31368169 TCACATGCACAGGTTCTGGAGGG + Intronic
1126101569 15:45121076-45121098 TCACACTCACAGGTGAGGGAGGG - Exonic
1131594979 15:93788737-93788759 CCAAATCCACATTTGATGGCAGG - Intergenic
1131711373 15:95059789-95059811 CCACATCCAATGGTGAGGGCAGG - Intergenic
1132534780 16:472771-472793 CCACATCCACAGCTGCTGGGTGG - Intronic
1134557174 16:15175329-15175351 CCTCAGGCACAGCTGATGGAGGG + Intergenic
1138376444 16:56567551-56567573 CCACAGTCACAGGCCATGGATGG - Intronic
1138443625 16:57049823-57049845 CCCCAACCACAGGTAATGGAGGG - Intronic
1139112918 16:63914007-63914029 CCACATTCACATGTGAATGAAGG + Intergenic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1140860039 16:79010459-79010481 ACCAATCCACAGGTGATGGCGGG + Intronic
1141876744 16:86830167-86830189 CCACCAGCAGAGGTGATGGAGGG - Intergenic
1142541235 17:661033-661055 CCACATACACAGATCATGGGCGG + Intronic
1142759627 17:2035106-2035128 CCACACCCCCAGGGGAAGGATGG + Intronic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1147198813 17:38785705-38785727 ACACATACACAGTTGTTGGAAGG + Intronic
1147518340 17:41143259-41143281 CCATATCAACAGGTTATGGGAGG + Intergenic
1148606856 17:48936200-48936222 CTACATCAACAGGTGTTGAAGGG - Exonic
1150310884 17:64129138-64129160 CCAAATCCACAGCTGAGTGAAGG + Intronic
1150463219 17:65370541-65370563 CCACATCCAGAAGTGATGGCTGG + Intergenic
1151103804 17:71588472-71588494 CCACTCCCACAGAGGATGGAAGG - Intergenic
1152114390 17:78376458-78376480 CCACTTCCACAGATTATGCAGGG - Intergenic
1153955677 18:10093661-10093683 CTACATCACCAGGTGATAGAAGG - Intergenic
1159566794 18:70060229-70060251 CTACATCCACACATGGTGGAAGG - Intronic
1161841873 19:6686735-6686757 CCACAGCCAAAGGTGAGGGTTGG - Exonic
1163409687 19:17146293-17146315 ACCCATCCACCTGTGATGGATGG - Intronic
1164884271 19:31764246-31764268 CCAAATGCAGAGGTGTTGGAAGG + Intergenic
1168320837 19:55508651-55508673 CCTCATCCACAGGGGATGGGGGG + Intronic
1168320859 19:55508725-55508747 CCTCATCCACAGGGGATGGGGGG + Intronic
1168320902 19:55508872-55508894 CCTCATCCACAGGGGATGGGGGG + Intronic
1168475281 19:56670636-56670658 ACACACCCACAGGGGATGGCTGG + Intronic
1168488421 19:56785732-56785754 TCACATACACAGGTATTGGATGG + Intronic
925524609 2:4786218-4786240 CCACATACACAGGTGAAAGGTGG - Intergenic
925831196 2:7897290-7897312 CTTCATCTACAGGTTATGGAAGG - Intergenic
927260919 2:21089245-21089267 CCACATCCATATTTGATGTACGG + Intergenic
928797593 2:35040704-35040726 TCACATCCAGAGCTGATGCAAGG - Intergenic
930357028 2:50333993-50334015 GGACATCCACAAGTGAAGGATGG + Intronic
932742834 2:74304853-74304875 CCAAATCAACAGTTGCTGGAGGG + Intronic
935038660 2:99404320-99404342 CCACATCCACTGGGGAGGGGAGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936251897 2:110873889-110873911 CCTCATACACTGGTGAGGGAAGG - Intronic
936812049 2:116413838-116413860 GCACATCATCAGGGGATGGATGG - Intergenic
937958536 2:127437684-127437706 CCACAACCACTGGGGATAGAGGG - Intronic
939077177 2:137617821-137617843 CTACATCCTCAGAGGATGGAAGG + Intronic
942810726 2:179997404-179997426 TCTCATCCTCAGGTGAGGGAGGG - Intronic
945267093 2:207901260-207901282 CCTGATCCACAGATGATTGAAGG - Intronic
945901602 2:215543988-215544010 CCACATCAACATGTAAGGGAGGG + Intergenic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
947752396 2:232539849-232539871 CCACAGCCTCAGGGGATGGAGGG + Intronic
948600007 2:239102323-239102345 GCACCTGCACAGGTGGTGGAGGG - Intronic
948831511 2:240600614-240600636 CCACAGCCACTGCTGCTGGAGGG - Intronic
1169123625 20:3111861-3111883 CTCCATCCACATGTGATGAATGG + Intronic
1169347346 20:4839171-4839193 CCAGAGCCACAGGTGTTGGGAGG + Intergenic
1170128137 20:12988500-12988522 CCACCTCCAGAGGTGATGGGGGG - Intergenic
1170391873 20:15884113-15884135 TCACATGCCCAGGGGATGGATGG + Intronic
1170872638 20:20220797-20220819 ACACATTCAAAAGTGATGGAAGG - Intronic
1172494840 20:35373059-35373081 CCAGTTCCACAGGTTTTGGAAGG - Intronic
1173870380 20:46338022-46338044 CGACATCCACAGCTGATGCAGGG + Intergenic
1175624677 20:60480760-60480782 CCACATTCACAGGGCATGAAAGG - Intergenic
1175726513 20:61322259-61322281 CCACATACACAGGAGAGGGGAGG + Intronic
1178632901 21:34278084-34278106 CCACTTCCATAGGGCATGGAAGG + Intergenic
1179101505 21:38358994-38359016 CAACAGCCACAGGTGATGGATGG + Intergenic
1179873936 21:44258073-44258095 TCACATTCACAGGTAAGGGATGG + Intronic
1180163738 21:46009503-46009525 CCCCAACCCCCGGTGATGGATGG - Intergenic
1180992138 22:19942958-19942980 CCCCATCCTCAGGTGTTGGCTGG + Intronic
1181442423 22:22943565-22943587 CCACATCCAGAGCTGTTGAATGG - Intergenic
1182335582 22:29581219-29581241 CCAACTCCGCAGGTGCTGGACGG + Exonic
1182771662 22:32801304-32801326 CCGCTTCCACAGGTGAGGGGTGG - Intronic
1183828163 22:40404546-40404568 CCGCATCCACAGCTGAGGGAAGG - Exonic
1184977285 22:48071370-48071392 CCCCATCCCCAGGTACTGGATGG + Intergenic
951390128 3:22092366-22092388 CCACATCCACAGCTTTTGCAGGG + Intronic
951425885 3:22544637-22544659 TCACATCTAGATGTGATGGAGGG - Intergenic
951911547 3:27755378-27755400 CCTCTTCTACAGGGGATGGAGGG + Intergenic
951975235 3:28499470-28499492 CCACATCAAAAAGTGGTGGAAGG - Intronic
954366934 3:50151272-50151294 CCTCATCCAATGGGGATGGAGGG + Intergenic
956008822 3:64808600-64808622 CCACATCTGTAGGAGATGGAAGG + Intergenic
957392719 3:79598705-79598727 CCAGAATCTCAGGTGATGGAGGG - Intronic
959790589 3:110356618-110356640 CCACTTCCACAGGGGAGGGTGGG + Intergenic
960215290 3:115026754-115026776 CAATATACACAGGTGATGAAAGG - Intronic
960436505 3:117633419-117633441 CAACATTCACAGGTGACAGATGG + Intergenic
964413910 3:156427769-156427791 CCACATACACAGGTGATATGGGG + Intronic
966743092 3:183252185-183252207 CAACATACACATGTGATGGCTGG + Intronic
968736673 4:2300833-2300855 CCACAACCACAGGGGCTGCAGGG + Intronic
969503546 4:7569904-7569926 CCACATCCACAGGGGTGGGGAGG - Intronic
970502139 4:16689072-16689094 CTACATGCCCTGGTGATGGAAGG + Intronic
970519696 4:16870118-16870140 CGACATTCAGAGGTGAAGGAAGG + Intronic
972269927 4:37501471-37501493 CCACAACCAGGGGTGAGGGATGG - Intronic
973681700 4:53327286-53327308 GGACATCCACATGGGATGGAGGG + Intronic
981529336 4:145736519-145736541 CCTGCTCCACAGCTGATGGACGG - Intronic
981642747 4:146964047-146964069 CCACATCCTCATGTGGTAGAAGG + Intergenic
983175621 4:164585216-164585238 CCACATCCATAGGAAAGGGAGGG - Intergenic
986830992 5:11578164-11578186 TCACATCCACTGTTGATTGAGGG + Intronic
987001176 5:13661734-13661756 CCACACCCACACTTGAGGGAAGG + Intergenic
987349512 5:17009372-17009394 ACAGATACACAGATGATGGATGG - Intergenic
988773583 5:34455135-34455157 CCCCATTCACAGTTGATGGGAGG + Intergenic
988913850 5:35872794-35872816 CCACATAAACAGCTGATAGATGG + Intronic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
990522779 5:56595739-56595761 CCACAGCCACAGGGCTTGGAGGG - Intronic
990982913 5:61617670-61617692 TCACATCCACAAGTGATGCCTGG - Intergenic
991416323 5:66396667-66396689 CCACAGCCCCTGGGGATGGAGGG - Intergenic
992530598 5:77648279-77648301 CAACATGCAGAGGTGATGGCAGG - Intergenic
995977545 5:118058466-118058488 TATCATCCAAAGGTGATGGAGGG - Intergenic
996024395 5:118628946-118628968 CCAAATCCAAAGGGGCTGGAAGG - Intergenic
996106917 5:119516142-119516164 CCATATAATCAGGTGATGGAGGG + Intronic
996190046 5:120528675-120528697 CCAAATCCAGAGGTGATTTATGG + Intronic
996290288 5:121844675-121844697 TCACATTCACAGGTTCTGGATGG + Intergenic
1000695144 5:164371567-164371589 CCACATCCACATGTCAGGGAGGG - Intergenic
1001654932 5:173342130-173342152 CCACATCCACAGTTCATGGAAGG - Intergenic
1001660733 5:173390805-173390827 CCTCACCCACAAGTGATAGATGG + Intergenic
1001897839 5:175396828-175396850 CCACAGTCACAGGTGATAAAGGG + Intergenic
1002390824 5:178910391-178910413 CAACATCCTCAGGAGATGGTGGG - Intronic
1003034341 6:2630026-2630048 TCACATTCACAGGTTATGGGTGG - Intronic
1003396857 6:5760809-5760831 CCAAATGAACTGGTGATGGAAGG - Intronic
1007234712 6:40382317-40382339 CCACATCTAAAGGTGGGGGAAGG - Intergenic
1007600475 6:43077706-43077728 CCACCTTCAAAGGAGATGGAAGG - Intronic
1008004797 6:46399875-46399897 TCACATTCACAGGTTCTGGATGG + Intronic
1009594353 6:65715245-65715267 CTGCATCCACACATGATGGAAGG + Intergenic
1009879188 6:69544084-69544106 ACTCATCCACAGGTGATGAAAGG + Intergenic
1010274783 6:73956756-73956778 CCACATTCACAGGTAAGGAAGGG - Intergenic
1011216408 6:85010628-85010650 CCACATCCACTGGAGTTAGATGG + Intergenic
1012264070 6:97119953-97119975 CGAAATCCAGAGGTGAAGGAGGG + Intronic
1012417976 6:99030586-99030608 TCAAAATCACAGGTGATGGAAGG + Intergenic
1012426910 6:99124770-99124792 ACACATCCAGAGGTGAACGATGG - Intergenic
1013010321 6:106114727-106114749 CCACATGCGACGGTGATGGAGGG - Intergenic
1013646971 6:112154235-112154257 GCACATCCAAGGGTGAGGGAGGG - Intronic
1015939361 6:138432659-138432681 ACAAATCCTCAGGTAATGGAAGG - Exonic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1021679792 7:23118583-23118605 ACTCTTCCACATGTGATGGATGG + Intronic
1022162171 7:27722086-27722108 CTAGATCCACAGGTCTTGGATGG + Intergenic
1023547210 7:41330614-41330636 CCTCATCCACTGGGAATGGAGGG + Intergenic
1032668430 7:134061709-134061731 GTAGATGCACAGGTGATGGAGGG - Intronic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1035194163 7:157201467-157201489 TCACAGCCACAGGGGAGGGAGGG + Intronic
1039696132 8:39913998-39914020 CCAAATCCACAGGTAAGAGAAGG + Exonic
1040588556 8:48767087-48767109 CCCCATCCTCACATGATGGAAGG - Intergenic
1043619157 8:82166394-82166416 CTACATGCACAAGAGATGGAAGG + Intergenic
1044932629 8:97264636-97264658 CCAAATCCAAAGATGTTGGAGGG + Intergenic
1045464925 8:102461074-102461096 CCACATCCACACCTGACGGTAGG - Intergenic
1045825131 8:106388309-106388331 CCAAATGCACAGGTATTGGATGG - Intronic
1047876323 8:129141642-129141664 CCACATTCACAGGTTCTGGGTGG + Intergenic
1048661693 8:136610949-136610971 CCTCATCCTCACATGATGGAAGG + Intergenic
1048925059 8:139264208-139264230 CCCAAGCCACATGTGATGGAAGG + Intergenic
1051680236 9:19600082-19600104 TGACATTCACAGGTGATGTATGG - Intronic
1052352445 9:27471134-27471156 ACACATCCACTGGTGAGGGGTGG - Intronic
1053352787 9:37424557-37424579 CCACATTCACAGGGGCTGGGCGG - Intronic
1056663277 9:88560199-88560221 CCACATCCAGAGGTCCAGGAAGG - Intronic
1057092016 9:92266787-92266809 CTACATCCACTTATGATGGAAGG - Intronic
1057275710 9:93675091-93675113 CCACATTCTCAGGGGCTGGAGGG - Intronic
1061223025 9:129263245-129263267 GGACATCCACAGGTGCTGGATGG + Intergenic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1185832476 X:3315274-3315296 CCACTGCCATAGATGATGGATGG + Intronic
1186895781 X:14003239-14003261 CCACATTCACAGGAAGTGGAAGG - Intergenic
1187143898 X:16620113-16620135 CCACTTCCAGAGGAGATGGGCGG - Intronic
1188352649 X:29151075-29151097 CAACATCCAGATGTGGTGGAAGG - Intronic
1191965173 X:66750369-66750391 CCACATCCATAGGAAAAGGAGGG - Intergenic
1192978968 X:76318661-76318683 CCACATCCACAGGAAATGAGGGG - Intergenic
1193722573 X:85004131-85004153 CGACAACCACAGGGGATTGAGGG - Intronic
1196787164 X:119430944-119430966 CCACATCCACCAGTGATGTGCGG + Intronic
1199634906 X:149805571-149805593 CCACATCCTGGGCTGATGGAGGG + Intergenic
1199894448 X:152117474-152117496 CCACATCCAGGGCTGAAGGAGGG - Intergenic
1200018045 X:153180482-153180504 CCCCATCCAGGGCTGATGGAGGG + Intronic
1200056767 X:153465690-153465712 CCACATGCACAGCGCATGGAAGG + Intronic