ID: 904870656

View in Genome Browser
Species Human (GRCh38)
Location 1:33615800-33615822
Sequence CTGTGGTTTCACCACGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904870656_904870660 30 Left 904870656 1:33615800-33615822 CCTACACCGTGGTGAAACCACAG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 904870660 1:33615853-33615875 TCCCTTACCTCCCTGCCCCAAGG 0: 1
1: 1
2: 1
3: 51
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904870656 Original CRISPR CTGTGGTTTCACCACGGTGT AGG (reversed) Intronic